DLL4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10171-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DLL4 Reagents
CRO Services
Product recommended

All DLL4 Reagents
DLL4 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2058 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human delta-like 4 (Drosophila) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
KpnI(two restriction sites) + XbaI (6kb + 1.72kb + 0.35kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
DLL4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DLL4 cDNA ORF Clone, Human, N-Myc tag Validated Images
Human DLL4/Delta-like 4 Gene Plasmid Map 5946
DLL4 cDNA ORF Clone, Human, N-Myc tag Alternative Names
Delta-like 4 cDNA ORF Clone, Human;hdelta2 cDNA ORF Clone, Human
DLL4 Background Information

Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch ligands in mammals and interacts predominantly with Notch 1, which has a key role in vascular development. Recent studies yield substantial insights into the role of DLL4 in angiogenesis. DLL4 is induced by vascular endothelial growth factor (VEGF) and acts downstream of VEGF as a 'brake' on VEGF-induced vessel growth, forming an autoregulatory negative feedback loop inactivating VEGF. DLL4 is downstream of VEGF signaling and its activation triggers a negative feedback that restrains the effects of VEGF. Attenuation of DLL4/Notch signaling results in chaotic vascular network with excessive branching and sprouting. DLL4 is widely distributed in tissues other than vessels including many malignancies. Furthermore, the molecule is internalized on binding its receptor and often transported to the nucleus. In pathological conditions, such as cancer, DLL4 is up-regulated strongly in the tumour vasculature. Blockade of DLL4-mediated Notch signaling strikingly increases nonproductive angiogenesis, but significantly inhibits tumor growth in preclinical mouse models. In preclinical studies, blocking of DLL4/Notch signaling is associated with a paradoxical increase in tumor vessel density, yet causes marked growth inhibition due to functionally defective vasculature. Thus, DLL4 blockade holds promise as an additional strategy for angiogenesis-based cancer therapy.

Full Name
delta-like 4 (Drosophila)
References
  • Yan M, et al. (2007) Delta-like 4/Notch signaling and its therapeutic implications. Clin Cancer Res. 13(24): 7243-6.
  • Sainson RC, et al. (2007) Anti-Dll4 therapy: can we block tumour growth by increasing angiogenesis? Trends Mol Med. 13(9): 389-95.
  • Martinez JC, et al. (2009) Nuclear and membrane expression of the angiogenesis regulator delta-like ligand 4 (DLL4) in normal and malignant human tissues. Histopathology. 54(5): 598-606.
  • Li JL, et al. (2010) Targeting DLL4 in tumors shows preclinical activity but potentially significant toxicity. Future Oncol. 6(7): 1099-103.
  • DLL4 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    DLL4 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90882-G

    DLL4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DLL4 cDNA ORF Clone in Cloning Vector, Mouse MG50640-G
    DLL4 cDNA ORF Clone, Mouse, untagged MG50640-UT
    DLL4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50640-ACG
    DLL4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50640-ACGLN
    DLL4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50640-ACR
    DLL4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50640-CF
    DLL4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50640-NF
    DLL4 cDNA ORF Clone, Mouse, C-His tag MG50640-CH
    DLL4 cDNA ORF Clone, Mouse, N-His tag MG50640-NH
    DLL4 cDNA ORF Clone, Mouse, C-HA tag MG50640-CY
    DLL4 cDNA ORF Clone, Mouse, N-HA tag MG50640-NY
    DLL4 cDNA ORF Clone, Mouse, C-Myc tag MG50640-CM
    DLL4 cDNA ORF Clone, Mouse, N-Myc tag MG50640-NM
    DLL4 qPCR Primer Pairs, Mouse MP200620

    DLL4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DLL4 cDNA ORF Clone in Cloning Vector, Human HG10171-M
    DLL4 cDNA ORF Clone, Human, untagged HG10171-UT
    DLL4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10171-ACG
    DLL4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10171-ACGLN
    DLL4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10171-ACR
    DLL4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10171-CF
    DLL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10171-NF
    DLL4 cDNA ORF Clone, Human, C-His tag HG10171-CH
    DLL4 cDNA ORF Clone, Human, N-His tag HG10171-NH
    DLL4 cDNA ORF Clone, Human, C-HA tag HG10171-CY
    DLL4 cDNA ORF Clone, Human, N-HA tag HG10171-NY
    DLL4 cDNA ORF Clone, Human, C-Myc tag HG10171-CM
    DLL4 qPCR Primer Pairs, Human HP100239
    info info
    添加购物车成功! 添加购物车失败!