DLL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11635-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DLL1 Reagents

CRO Services

Product recommended


All DLL1 Reagents

DLL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2172 bp
Description
Full length Clone DNA of Human delta-like 1 (Drosophila) with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DLL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human DLL1 / Delta-like 1 Gene Expression validated Image 14372
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

DLL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

Delta cDNA ORF Clone, Human;DELTA1 cDNA ORF Clone, Human;DL1 cDNA ORF Clone, Human

DLL1 Background Information

Delta-like protein 1(DLL1), also known as Delta1, a single-pass type I membrane protein which contains one DSL domain and eight EGF-like domains,  acts as a ligand for Notch receptors, and positively regulates T-cell development. DLL1 is proteolytically processed in a similar manner to the Notch receptor, and it has been speculated to participate in bidirectional signaling. The proteolytic processing of DLL1 helps achieve an asymmetry in Notch signaling in initially equivalent myogenic cells and helps sustain the balance between differentiation and self-renewal. Interactions between DLL1 and Notch in trans activate the Notch pathway, whereas DLL1 binding to Notch in cis inhibits Notch signaling. DLL1 undergoes proteolytic processing in its extracellular domain by ADAM10. It had been demonstrated that DLL1 represents a substrate for several other members of the ADAM family. In co-transfected cells, DLL1 is constitutively cleaved by ADAM12, and the N-terminal fragment of DLL1 is released to medium. ADAM12-mediated cleavage of DLL1 is cell density-dependent, takes place in cis orientation, and does not require the presence of the cytoplasmic domain of ADAM12. Full-length DLL1, but not its N- or C-terminal proteolytic fragment, co-immunoprecipitates with ADAM12. By using a Notch reporter construct, we show that DLL1 processing by ADAM12 increases Notch signaling in a cell-autonomous manner. Furthermore, ADAM9 and ADAM17 have the ability to process DLL1. In contrast, ADAM15 does not cleave DLL1, although the two proteins still co-immunoprecipitate with each other. During fetal development, DLL1 is an essential Notch ligand in the vascular endothelium of large arteries to activate Notch1 and maintain arterial identity. DLL1-Notch signaling was required for VEGF receptor expression in fetal arteries.

Full Name
delta-like 1 (Drosophila)
References
  • Dyczynska E, et al. (2007) Proteolytic processing of delta-like 1 by ADAM proteases. J Biol Chem. 282(1): 436-44.
  • Sun D, et al. (2008) The role of Delta-like 1 shedding in muscle cell self-renewal and differentiation. J Cell Sci. 121(Pt 22): 3815-23.
  • Srensen I, et al. (2009) DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood. 113(22): 5680-8.
  • DLL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DLL1 cDNA ORF Clone in Cloning Vector, Rat RG80013-M
    DLL1 cDNA ORF Clone, Rat, untagged RG80013-UT
    DLL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80013-ACGLN
    DLL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80013-ACG
    DLL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80013-ACR
    DLL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80013-CF
    DLL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80013-NF
    DLL1 cDNA ORF Clone, Rat, C-His tag RG80013-CH
    DLL1 cDNA ORF Clone, Rat, N-His tag RG80013-NH
    DLL1 cDNA ORF Clone, Rat, C-HA tag RG80013-CY
    DLL1 cDNA ORF Clone, Rat, N-HA tag RG80013-NY
    DLL1 cDNA ORF Clone, Rat, C-Myc tag RG80013-CM
    DLL1 cDNA ORF Clone, Rat, N-Myc tag RG80013-NM
    DLL1 qPCR Primer Pairs, Rat RP300012

    DLL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DLL1 cDNA ORF Clone in Cloning Vector, Mouse MG50522-M
    DLL1 cDNA ORF Clone, Mouse, untagged MG50522-UT
    DLL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50522-ACGLN
    DLL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50522-ACG
    DLL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50522-ACR
    DLL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50522-CF
    DLL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50522-NF
    DLL1 cDNA ORF Clone, Mouse, C-His tag MG50522-CH
    DLL1 cDNA ORF Clone, Mouse, N-His tag MG50522-NH
    DLL1 cDNA ORF Clone, Mouse, C-HA tag MG50522-CY
    DLL1 cDNA ORF Clone, Mouse, N-HA tag MG50522-NY
    DLL1 cDNA ORF Clone, Mouse, C-Myc tag MG50522-CM
    DLL1 cDNA ORF Clone, Mouse, N-Myc tag MG50522-NM
    DLL1 qPCR Primer Pairs, Mouse MP200514

    DLL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DLL1 cDNA ORF Clone in Cloning Vector, Human HG11635-U
    DLL1 cDNA ORF Clone, Human, untagged HG11635-UT
    DLL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11635-ACGLN
    DLL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11635-ACG
    DLL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11635-ACR
    DLL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11635-NF
    DLL1 cDNA ORF Clone, Human, C-His tag HG11635-CH
    DLL1 cDNA ORF Clone, Human, N-His tag HG11635-NH
    DLL1 cDNA ORF Clone, Human, C-HA tag HG11635-CY
    DLL1 cDNA ORF Clone, Human, N-HA tag HG11635-NY
    DLL1 cDNA ORF Clone, Human, C-Myc tag HG11635-CM
    DLL1 cDNA ORF Clone, Human, N-Myc tag HG11635-NM
    DLL1 qPCR Primer Pairs, Human HP101486
    info info
    添加购物车成功! 添加购物车失败!