DEK cDNA ORF Clone, Human, N-Myc tag

Cat: HG14891-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DEK Reagents

CRO Services

Product recommended


All DEK Reagents

DEK cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human DEK oncogene with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.17kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DEK cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DEK cDNA ORF Clone, Human, N-Myc tag Validated Images

Human bFGF/FGF2 Gene Plasmid Map 5639

DEK cDNA ORF Clone, Human, N-Myc tag Alternative Names

D6S231E cDNA ORF Clone, Human

DEK Background Information

Full Name
DEK proto-oncogene

DEK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DEK cDNA ORF Clone in Cloning Vector, Rat RG89997-U
DEK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89997-ACGLN

DEK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DEK cDNA ORF Clone in Cloning Vector, Mouse MG5A0190-U
DEK cDNA ORF Clone, Mouse, untagged MG5A0190-UT
DEK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0190-ACG
DEK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0190-ACGLN
DEK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0190-ANG
DEK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0190-ACR
DEK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0190-ANR
DEK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0190-CF
DEK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0190-NF
DEK cDNA ORF Clone, Mouse, C-His tag MG5A0190-CH
DEK cDNA ORF Clone, Mouse, N-His tag MG5A0190-NH
DEK cDNA ORF Clone, Mouse, C-HA tag MG5A0190-CY
DEK cDNA ORF Clone, Mouse, N-HA tag MG5A0190-NY
DEK cDNA ORF Clone, Mouse, C-Myc tag MG5A0190-CM
DEK cDNA ORF Clone, Mouse, N-Myc tag MG5A0190-NM

DEK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DEK cDNA ORF Clone in Cloning Vector, Human HG14891-G
DEK cDNA ORF Clone, Human, untagged HG14891-UT
DEK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14891-ACGLN
DEK cDNA ORF Clone, Human, C-GFPSpark® tag HG14891-ACG
DEK cDNA ORF Clone, Human, N-GFPSpark® tag HG14891-ANG
DEK cDNA ORF Clone, Human, C-OFPSpark® tag HG14891-ACR
DEK cDNA ORF Clone, Human, N-OFPSpark® tag HG14891-ANR
DEK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14891-CF
DEK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14891-NF
DEK cDNA ORF Clone, Human, C-His tag HG14891-CH
DEK cDNA ORF Clone, Human, N-His tag HG14891-NH
DEK cDNA ORF Clone, Human, C-HA tag HG14891-CY
DEK cDNA ORF Clone, Human, N-HA tag HG14891-NY
DEK cDNA ORF Clone, Human, C-Myc tag HG14891-CM
DEK qPCR Primer Pairs, Human HP103520
info info
添加购物车成功! 添加购物车失败!