ZIP Kinase cDNA ORF Clone, Human, N-His tag

Cat: HG10757-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ZIP Kinase Reagents
CRO Services
Product recommended

All ZIP Kinase Reagents
ZIP Kinase cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1365 bp
Description
Full length Clone DNA of Human death-associated protein kinase 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZIP Kinase cDNA ORF Clone, Human, N-His tag Alternative Names
DLK cDNA ORF Clone, Human;ZIP cDNA ORF Clone, Human;ZIPK cDNA ORF Clone, Human
ZIP Kinase Background Information

Death-associated protein kinase 3, also known as DAP kinase 3, ZIP-kinase, DAPK3 and ZIPK, is a nucleus and cytoplasm protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and DAP kinase subfamily. DAPK3 / ZIPK contains one protein kinase domain. It is a serine/threonine kinase which acts as a positive regulator of apoptosis. It phosphorylates histone H3 on 'Thr-11' at centromeres during mitosis. DAPK3 / ZIPK is a homodimer or forms heterodimers with ATF4. Both interactions require an intact leucine zipper domain and oligomerization is required for full enzymatic activity. It also binds to DAXX and PAWR, possibly in a ternary complex which plays a role in caspase activation. DAPK3 / ZIPK regulates myosin light chain phosphatase through phosphorylation of MYPT1 thereby regulating the assembly of the actin cytoskeleton, cell migration, invasiveness of tumor cells, smooth muscle contraction and neurite outgrowth. It is involved in the formation of promyelocytic leukemia protein nuclear body (PML-NB), one of many subnuclear domains in the eukaryotic cell nucleus, and which is involved in oncogenesis and viral infection.

Full Name
death-associated protein kinase 3
References
  • Kawai T., et al., 1998, Mol. Cell. Biol. 18:1642-1651.
  • Murata-Hori M., et al., 1999, FEBS Lett. 451:81-84.
  • Kawai T., et al., 2003, Mol. Cell. Biol. 23:6174-6186.
  • Greenman C., et al., 2007, Nature 446:153-158.
  • Ohbayashi N., et al., 2008, Biochem. Biophys. Res. Commun. 372: 708 -712.
  • info info
    添加购物车成功! 添加购物车失败!