CYP20A1 cDNA ORF Clone, Human, C-HA tag

Cat: HG13437-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CYP20A1 Reagents

CRO Services

Product recommended


All CYP20A1 Reagents

CYP20A1 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1389 bp
Description
Full length Clone DNA of Human cytochrome P450, family 20, subfamily A, polypepti with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CYP20A1 cDNA ORF Clone, Human, C-HA tag Alternative Names

CYP-M cDNA ORF Clone, Human

CYP20A1 Background Information

Full Name
cytochrome P450, family 20, subfamily a, polypeptide 1

CYP20A1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CYP20A1 cDNA ORF Clone in Cloning Vector, Rat RG8A1033-U
CYP20A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1033-ACGLN

CYP20A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CYP20A1 cDNA ORF Clone in Cloning Vector, Mouse MG5A3584-U
CYP20A1 cDNA ORF Clone, Mouse, untagged MG5A3584-UT
CYP20A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3584-ACG
CYP20A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3584-ACGLN
CYP20A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3584-ANG
CYP20A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3584-ACR
CYP20A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3584-ANR
CYP20A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3584-CF
CYP20A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3584-NF
CYP20A1 cDNA ORF Clone, Mouse, C-His tag MG5A3584-CH
CYP20A1 cDNA ORF Clone, Mouse, N-His tag MG5A3584-NH
CYP20A1 cDNA ORF Clone, Mouse, C-HA tag MG5A3584-CY
CYP20A1 cDNA ORF Clone, Mouse, N-HA tag MG5A3584-NY
CYP20A1 cDNA ORF Clone, Mouse, C-Myc tag MG5A3584-CM
CYP20A1 cDNA ORF Clone, Mouse, N-Myc tag MG5A3584-NM

CYP20A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CYP20A1 cDNA ORF Clone in Cloning Vector, Human HG13437-G
CYP20A1 cDNA ORF Clone, Human, untagged HG13437-UT
CYP20A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13437-ACGLN
CYP20A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13437-ACG
CYP20A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13437-ACR
CYP20A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13437-CF
CYP20A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13437-NF
CYP20A1 cDNA ORF Clone, Human, C-His tag HG13437-CH
CYP20A1 cDNA ORF Clone, Human, N-His tag HG13437-NH
CYP20A1 cDNA ORF Clone, Human, N-HA tag HG13437-NY
CYP20A1 cDNA ORF Clone, Human, C-Myc tag HG13437-CM
CYP20A1 cDNA ORF Clone, Human, N-Myc tag HG13437-NM
CYP20A1 qPCR Primer Pairs, Human HP102139
info info
添加购物车成功! 添加购物车失败!