CYB5D2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13731-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CYB5D2 Reagents
CRO Services
Product recommended

All CYB5D2 Reagents
CYB5D2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Human cytochrome b5 domain containing 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CYB5D2 Background Information
Full Name
cytochrome b5 domain containing 2

CYB5D2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CYB5D2 cDNA ORF Clone in Cloning Vector, Mouse MG51858-G
CYB5D2 cDNA ORF Clone, Mouse, untagged MG51858-UT
CYB5D2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51858-ACGLN
CYB5D2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51858-ACG
CYB5D2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51858-ACR
CYB5D2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51858-CF
CYB5D2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51858-NF
CYB5D2 cDNA ORF Clone, Mouse, C-His tag MG51858-CH
CYB5D2 cDNA ORF Clone, Mouse, N-His tag MG51858-NH
CYB5D2 cDNA ORF Clone, Mouse, C-HA tag MG51858-CY
CYB5D2 cDNA ORF Clone, Mouse, N-HA tag MG51858-NY
CYB5D2 cDNA ORF Clone, Mouse, C-Myc tag MG51858-CM
CYB5D2 cDNA ORF Clone, Mouse, N-Myc tag MG51858-NM
CYB5D2 qPCR Primer Pairs, Mouse MP201731

CYB5D2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CYB5D2 cDNA ORF Clone in Cloning Vector, Human HG13731-G
CYB5D2 cDNA ORF Clone, Human, untagged HG13731-UT
CYB5D2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13731-ACGLN
CYB5D2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13731-ACG
CYB5D2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13731-ACR
CYB5D2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13731-CF
CYB5D2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13731-NF
CYB5D2 cDNA ORF Clone, Human, C-His tag HG13731-CH
CYB5D2 cDNA ORF Clone, Human, N-His tag HG13731-NH
CYB5D2 cDNA ORF Clone, Human, C-HA tag HG13731-CY
CYB5D2 cDNA ORF Clone, Human, N-HA tag HG13731-NY
CYB5D2 cDNA ORF Clone, Human, C-Myc tag HG13731-CM
CYB5D2 qPCR Primer Pairs, Human HP102408
info info
添加购物车成功! 添加购物车失败!