CSDE1 cDNA ORF Clone, Human, untagged

Cat: HG16149-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CSDE1 Reagents
CRO Services
Product recommended

All CSDE1 Reagents
CSDE1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2397 bp
Description
Full length Clone DNA of Human cold shock domain containing E1, RNA-binding.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CSDE1 cDNA ORF Clone, Human, untagged Alternative Names
D1S155E cDNA ORF Clone, Human;UNR cDNA ORF Clone, Human
CSDE1 Background Information
Full Name
cold shock domain containing E1, RNA-binding

CSDE1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CSDE1 cDNA ORF Clone in Cloning Vector, Mouse MG53332-U
CSDE1 cDNA ORF Clone, Mouse, untagged MG53332-UT
CSDE1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53332-ACGLN
CSDE1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53332-ACG
CSDE1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53332-ANG
CSDE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53332-ACR
CSDE1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53332-ANR
CSDE1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53332-CF
CSDE1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53332-NF
CSDE1 cDNA ORF Clone, Mouse, C-His tag MG53332-CH
CSDE1 cDNA ORF Clone, Mouse, N-His tag MG53332-NH
CSDE1 cDNA ORF Clone, Mouse, C-HA tag MG53332-CY
CSDE1 cDNA ORF Clone, Mouse, N-HA tag MG53332-NY
CSDE1 cDNA ORF Clone, Mouse, C-Myc tag MG53332-CM
CSDE1 cDNA ORF Clone, Mouse, N-Myc tag MG53332-NM

CSDE1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CSDE1 cDNA ORF Clone in Cloning Vector, Human HG16149-G
CSDE1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16149-ACGLN
CSDE1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16149-ACG
CSDE1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16149-ANG
CSDE1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16149-ACR
CSDE1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16149-ANR
CSDE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16149-CF
CSDE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16149-NF
CSDE1 cDNA ORF Clone, Human, C-His tag HG16149-CH
CSDE1 cDNA ORF Clone, Human, N-His tag HG16149-NH
CSDE1 cDNA ORF Clone, Human, C-HA tag HG16149-CY
CSDE1 cDNA ORF Clone, Human, N-HA tag HG16149-NY
CSDE1 cDNA ORF Clone, Human, C-Myc tag HG16149-CM
CSDE1 cDNA ORF Clone, Human, N-Myc tag HG16149-NM
CSDE1 qPCR Primer Pairs, Human HP104918
info info
添加购物车成功! 添加购物车失败!