CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10789-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CPA4 / Carboxypeptidase A4 Reagents

CRO Services

Product recommended


All CPA4 / Carboxypeptidase A4 Reagents

CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1266 bp
Description
Full length Clone DNA of Human carboxypeptidase A4 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, N-Myc tag Alternative Names

CPA3 cDNA ORF Clone, Human

CPA4 / Carboxypeptidase A4 Background Information

Full Name
carboxypeptidase A4

CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CPA4 / Carboxypeptidase A4 cDNA ORF Clone in Cloning Vector, Mouse MG5A5646-G
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, untagged MG5A5646-UT
CPA4 / Carboxypeptidase A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5646-ACGLN
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5646-ACG
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5646-ACR
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5646-CF
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5646-NF
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, C-His tag MG5A5646-CH
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, N-His tag MG5A5646-NH
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, C-HA tag MG5A5646-CY
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, N-HA tag MG5A5646-NY
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, C-Myc tag MG5A5646-CM
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Mouse, N-Myc tag MG5A5646-NM

CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CPA4 / Carboxypeptidase A4 cDNA ORF Clone in Cloning Vector, Human HG10789-M
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, untagged HG10789-UT
CPA4 / Carboxypeptidase A4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10789-ACGLN
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10789-ACG
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10789-ACR
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10789-CF
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10789-NF
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, C-His tag HG10789-CH
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, N-His tag HG10789-NH
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, C-HA tag HG10789-CY
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, N-HA tag HG10789-NY
CPA4 / Carboxypeptidase A4 cDNA ORF Clone, Human, C-Myc tag HG10789-CM
CPA4 / Carboxypeptidase A4 qPCR Primer Pairs, Human HP100703
info info
添加购物车成功! 添加购物车失败!