CNTN5 cDNA ORF Clone, Human, N-HA tag

Cat: HG10513-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CNTN5 Reagents
CRO Services
Product recommended

All CNTN5 Reagents
CNTN5 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3303 bp
Description
Full length Clone DNA of Human contactin 5 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNTN5 cDNA ORF Clone, Human, N-HA tag Alternative Names
HNB-2s cDNA ORF Clone, Human;NB-2 cDNA ORF Clone, Human
CNTN5 Background Information

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed mainly in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-5, also known as NB-2, is one of the neural recognition molecules in the contactin subgroup. Contactin-5 is expressed in brain and kidney and at very low level in placenta. In brain, Contactin-5 is highly expressed in the occipital lobe, amygdala, cerebral cortex, frontal lobe, thalamus and temporal lobe. Mice deficient in the Contactin-5 gene exhibit aberrant responses to acoustic stimuli. Contactin-5 may play a role in maturation of glutamatergic synapses in the brainstem during the final stages of auditory development. Contactin-5 gene may contribute to human neurological disorders.

Full Name
contactin 5
References
  • Kamei Y, et al. (2000) Human NB-2 of the contactin subgroup molecules: chromosomal localization of the gene (CNTN5) and distinct expression pattern from other subgroup members. Genomics 69(1):113-9.
  • Ogawa J, et al. (2001) Neural recognition molecule NB-2 of the contactin/F3 subgroup in rat: Specificity in neurite outgrowth-promoting activity and restricted expression in the brain regions. J Neurosci Res. 65(2):100-10.
  • Li H, et al. (2003) Aberrant responses to acoustic stimuli in mice deficient for neural recognition molecule NB-2. Eur J Neurosci. 17(5):929-36.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Toyoshima M, et al. (2009) Preferential localization of neural cell recognition molecule NB-2 in developing glutamatergic neurons in the rat auditory brainstem. J Comp Neurol. 513(4):349-62.
  • CNTN5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CNTN5 cDNA ORF Clone in Cloning Vector, Rat RG80409-G
    CNTN5 cDNA ORF Clone, Rat, untagged RG80409-UT
    CNTN5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80409-ACG
    CNTN5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80409-ACGLN
    CNTN5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80409-ACR
    CNTN5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80409-CF
    CNTN5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80409-NF
    CNTN5 cDNA ORF Clone, Rat, C-His tag RG80409-CH
    CNTN5 cDNA ORF Clone, Rat, N-His tag RG80409-NH
    CNTN5 cDNA ORF Clone, Rat, C-HA tag RG80409-CY
    CNTN5 cDNA ORF Clone, Rat, N-HA tag RG80409-NY
    CNTN5 cDNA ORF Clone, Rat, C-Myc tag RG80409-CM
    CNTN5 cDNA ORF Clone, Rat, N-Myc tag RG80409-NM
    CNTN5 qPCR Primer Pairs, Rat RP300373

    CNTN5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CNTN5 cDNA ORF Clone in Cloning Vector, Mouse MG51092-G
    CNTN5 cDNA ORF Clone, Mouse, untagged MG51092-UT
    CNTN5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51092-ACGLN
    CNTN5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51092-ACG
    CNTN5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51092-ACR
    CNTN5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51092-CF
    CNTN5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51092-NF
    CNTN5 cDNA ORF Clone, Mouse, C-His tag MG51092-CH
    CNTN5 cDNA ORF Clone, Mouse, N-His tag MG51092-NH
    CNTN5 cDNA ORF Clone, Mouse, C-HA tag MG51092-CY
    CNTN5 cDNA ORF Clone, Mouse, N-HA tag MG51092-NY
    CNTN5 cDNA ORF Clone, Mouse, C-Myc tag MG51092-CM
    CNTN5 cDNA ORF Clone, Mouse, N-Myc tag MG51092-NM
    CNTN5 qPCR Primer Pairs, Mouse MP201049

    CNTN5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CNTN5 cDNA ORF Clone in Cloning Vector, Human HG10513-M
    CNTN5 cDNA ORF Clone, Human, untagged HG10513-UT
    CNTN5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10513-ACG
    CNTN5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10513-ACGLN
    CNTN5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10513-ACR
    CNTN5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10513-CF
    CNTN5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10513-NF
    CNTN5 cDNA ORF Clone, Human, C-His tag HG10513-CH
    CNTN5 cDNA ORF Clone, Human, N-His tag HG10513-NH
    CNTN5 cDNA ORF Clone, Human, C-HA tag HG10513-CY
    CNTN5 cDNA ORF Clone, Human, C-Myc tag HG10513-CM
    CNTN5 cDNA ORF Clone, Human, N-Myc tag HG10513-NM
    CNTN5 qPCR Primer Pairs, Human HP100533
    info info
    添加购物车成功! 添加购物车失败!