CNBP cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14576-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CNBP Reagents
CRO Services
Product recommended

All CNBP Reagents
CNBP cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
513 bp
Description
Full length Clone DNA of Human CCHC-type zinc finger, nucleic acid binding protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNBP cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CNBP1 cDNA ORF Clone, Human;DM2 cDNA ORF Clone, Human;PROMM cDNA ORF Clone, Human;RNF163 cDNA ORF Clone, Human;ZCCHC22 cDNA ORF Clone, Human;ZNF9 cDNA ORF Clone, Human
CNBP Background Information
Full Name
CCHC-type zinc finger, nucleic acid binding protein

CNBP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CNBP cDNA ORF Clone in Cloning Vector, Rat RG81312-U
CNBP cDNA ORF Clone, Rat, untagged RG81312-UT
CNBP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81312-ACGLN
CNBP cDNA ORF Clone, Rat, C-GFPSpark® tag RG81312-ACG
CNBP cDNA ORF Clone, Rat, N-GFPSpark® tag RG81312-ANG
CNBP cDNA ORF Clone, Rat, C-OFPSpark® tag RG81312-ACR
CNBP cDNA ORF Clone, Rat, N-OFPSpark® tag RG81312-ANR
CNBP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81312-CF
CNBP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81312-NF
CNBP cDNA ORF Clone, Rat, C-His tag RG81312-CH
CNBP cDNA ORF Clone, Rat, N-His tag RG81312-NH
CNBP cDNA ORF Clone, Rat, C-HA tag RG81312-CY
CNBP cDNA ORF Clone, Rat, N-HA tag RG81312-NY
CNBP cDNA ORF Clone, Rat, C-Myc tag RG81312-CM
CNBP cDNA ORF Clone, Rat, N-Myc tag RG81312-NM
CNBP qPCR Primer Pairs, Rat RP301268

CNBP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CNBP cDNA ORF Clone in Cloning Vector, Mouse MG53643-U
CNBP cDNA ORF Clone, Mouse, untagged MG53643-UT
CNBP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53643-ACGLN
CNBP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53643-ACG
CNBP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53643-ANG
CNBP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53643-ACR
CNBP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53643-ANR
CNBP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53643-CF
CNBP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53643-NF
CNBP cDNA ORF Clone, Mouse, C-His tag MG53643-CH
CNBP cDNA ORF Clone, Mouse, N-His tag MG53643-NH
CNBP cDNA ORF Clone, Mouse, C-HA tag MG53643-CY
CNBP cDNA ORF Clone, Mouse, N-HA tag MG53643-NY
CNBP cDNA ORF Clone, Mouse, C-Myc tag MG53643-CM
CNBP cDNA ORF Clone, Mouse, N-Myc tag MG53643-NM

CNBP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CNBP cDNA ORF Clone in Cloning Vector, Human HG14576-G
CNBP cDNA ORF Clone in Cloning Vector, Human HG29709-U
CNBP cDNA ORF Clone, Human, untagged HG14576-UT
CNBP cDNA ORF Clone, Human, C-GFPSpark® tag HG14576-ACG
CNBP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14576-ACGLN
CNBP cDNA ORF Clone, Human, N-GFPSpark® tag HG14576-ANG
CNBP cDNA ORF Clone, Human, C-OFPSpark® tag HG14576-ACR
CNBP cDNA ORF Clone, Human, N-OFPSpark® tag HG14576-ANR
CNBP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14576-CF
CNBP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29709-NF
CNBP cDNA ORF Clone, Human, C-His tag HG14576-CH
CNBP cDNA ORF Clone, Human, N-His tag HG14576-NH
CNBP cDNA ORF Clone, Human, C-HA tag HG14576-CY
CNBP cDNA ORF Clone, Human, N-HA tag HG14576-NY
CNBP cDNA ORF Clone, Human, C-Myc tag HG14576-CM
CNBP cDNA ORF Clone, Human, N-Myc tag HG14576-NM
CNBP qPCR Primer Pairs, Human HP103212
info info
添加购物车成功! 添加购物车失败!