CHP1 cDNA ORF Clone, Human, N-His tag

Cat: HG11379-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CHP1 Reagents
CRO Services
Product recommended

All CHP1 Reagents
CHP1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
588 bp
Description
Full length Clone DNA of Human calcineurin-like EF-hand protein 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About CHP1
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHP1 cDNA ORF Clone, Human, N-His tag Alternative Names
CHP cDNA ORF Clone, Human;p22 cDNA ORF Clone, Human;p24 cDNA ORF Clone, Human;Sid470p cDNA ORF Clone, Human;SLC9A1BP cDNA ORF Clone, Human
CHP1 Background Information
Full Name
calcineurin-like EF-hand protein 1

CHP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CHP1 cDNA ORF Clone in Cloning Vector, Rat RG83671-U
CHP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83671-ACGLN

CHP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHP1 cDNA ORF Clone in Cloning Vector, Mouse MG51269-U
CHP1 cDNA ORF Clone, Mouse, untagged MG51269-UT
CHP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51269-ACGLN
CHP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51269-ACG
CHP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51269-ANG
CHP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51269-ACR
CHP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51269-ANR
CHP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51269-CF
CHP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51269-NF
CHP1 cDNA ORF Clone, Mouse, C-His tag MG51269-CH
CHP1 cDNA ORF Clone, Mouse, N-His tag MG51269-NH
CHP1 cDNA ORF Clone, Mouse, C-HA tag MG51269-CY
CHP1 cDNA ORF Clone, Mouse, N-HA tag MG51269-NY
CHP1 cDNA ORF Clone, Mouse, C-Myc tag MG51269-CM
CHP1 cDNA ORF Clone, Mouse, N-Myc tag MG51269-NM
CHP1 qPCR Primer Pairs, Mouse MP201151

CHP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHP1 cDNA ORF Clone in Cloning Vector, Human HG11379-M
CHP1 cDNA ORF Clone, Human, untagged HG11379-UT
CHP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11379-ACG
CHP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11379-ACGLN
CHP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11379-ANG
CHP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11379-ACR
CHP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11379-ANR
CHP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11379-CF
CHP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11379-NF
CHP1 cDNA ORF Clone, Human, C-His tag HG11379-CH
CHP1 cDNA ORF Clone, Human, C-HA tag HG11379-CY
CHP1 cDNA ORF Clone, Human, N-HA tag HG11379-NY
CHP1 cDNA ORF Clone, Human, C-Myc tag HG11379-CM
CHP1 cDNA ORF Clone, Human, N-Myc tag HG11379-NM
CHP1 qPCR Primer Pairs, Human HP101260
info info
添加购物车成功! 添加购物车失败!