p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-His tag

Cat: HG11109-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All p27/Kip1/CDKN1B Reagents

CRO Services

Product recommended


All p27/Kip1/CDKN1B Reagents

p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
642 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1B (p27, Kip1) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.64kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

p27/Kip1/CDKN1B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-His tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5610

p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-His tag Alternative Names

CDKN4 cDNA ORF Clone, Human;KIP1 cDNA ORF Clone, Human;MEN1B cDNA ORF Clone, Human;MEN4 cDNA ORF Clone, Human;P27KIP1 cDNA ORF Clone, Human

p27/Kip1/CDKN1B Background Information

Full Name
cyclin-dependent kinase inhibitor 1B (p27, Kip1)

p27/Kip1/CDKN1B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
p27/Kip1/CDKN1B cDNA ORF Clone in Cloning Vector, Rat RG81443-G

p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
p27/Kip1/CDKN1B cDNA ORF Clone in Cloning Vector, Mouse MG56976-U
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, untagged MG56976-UT
p27/Kip1/CDKN1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56976-ACGLN
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56976-ACG
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG56976-ANG
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG56976-ACR
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG56976-ANR
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG56976-CF
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG56976-NF
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, C-His tag MG56976-CH
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, N-His tag MG56976-NH
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, C-HA tag MG56976-CY
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, N-HA tag MG56976-NY
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, C-Myc tag MG56976-CM
p27/Kip1/CDKN1B cDNA ORF Clone, Mouse, N-Myc tag MG56976-NM

p27/Kip1/CDKN1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
p27/Kip1/CDKN1B cDNA ORF Clone in Cloning Vector, Human HG11109-M
p27/Kip1/CDKN1B cDNA ORF Clone, Human, untagged HG11109-UT
p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-GFPSpark® tag HG11109-ACG
p27/Kip1/CDKN1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11109-ACGLN
p27/Kip1/CDKN1B cDNA ORF Clone, Human, N-GFPSpark® tag HG11109-ANG
p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-OFPSpark® tag HG11109-ACR
p27/Kip1/CDKN1B cDNA ORF Clone, Human, N-OFPSpark® tag HG11109-ANR
p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11109-CF
p27/Kip1/CDKN1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11109-NF
p27/Kip1/CDKN1B cDNA ORF Clone, Human, N-His tag HG11109-NH
p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-HA tag HG11109-CY
p27/Kip1/CDKN1B cDNA ORF Clone, Human, N-HA tag HG11109-NY
p27/Kip1/CDKN1B cDNA ORF Clone, Human, C-Myc tag HG11109-CM
p27/Kip1/CDKN1B cDNA ORF Clone, Human, N-Myc tag HG11109-NM
p27/Kip1/CDKN1B qPCR Primer Pairs, Human HP101024
info info
添加购物车成功! 添加购物车失败!