CD99L2 cDNA ORF Clone, Human, C-HA tag

Cat: HG15760-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD99L2 Reagents

CRO Services

Product recommended


All CD99L2 Reagents

CD99L2 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
789 bp
Description
Full length Clone DNA of Human CD99 molecule-like 2 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD99L2 cDNA ORF Clone, Human, C-HA tag Alternative Names

CD99B cDNA ORF Clone, Human;MIC2L1 cDNA ORF Clone, Human

CD99L2 Background Information

CD99 antigen-like protein 2, also known as MIC2-like protein 1, CD99L2 and MIC2L1, is a single-pass type I  membrane protein which belongs to the CD99 family. CD99L2 is expressed in brain, heart, lung, liver, spleen, kidney, stomach, small intestine, skeletal muscle, ovary, thymus, testis and uterus. Lower expression of CD99L2 is seen in thymus. It is also expressed in E18 uterus and placenta. CD99 and CD99L2 were required for leukocyte extravasation in the cremaster after stimulation with tumor necrosis factor-alpha, where the need for PECAM-1 is known to be bypassed. CD99 and CD99L2 act independently of PECAM-1 in leukocyte extravasation and cooperate in an independent way to help neutrophils overcome the endothelial basement membrane. CD99L2 may function as a homophilic adhesion molecule. It functions in leukocyte-endothelial cell interactions during leukocyte extravasation, and in particular, at the diapedesis step. CD99L2 does not seem to be involved in docking of leukocytes to the vessel wall or in lymphocyte diapedesis.

Full Name
CD99 molecule-like 2
References
  • Suh, YH. et al., 2003, Gene. 307: 63-76.
  • Park,S.H. Gene 2005, 353 (2):177-88.
  • Schenkel, AR et al., 2007, Cell Commun Adhes. 14 (5):227-37.
  • Bixel, MG. et al., 2010, Blood. 116 (7):1172-84. 
  • CD99L2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD99L2 cDNA ORF Clone in Cloning Vector, Mouse MG50526-M
    CD99L2 cDNA ORF Clone, Mouse, untagged MG50526-UT
    CD99L2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50526-ACGLN
    CD99L2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50526-CF
    CD99L2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50526-NF
    CD99L2 cDNA ORF Clone, Mouse, C-His tag MG50526-CH
    CD99L2 cDNA ORF Clone, Mouse, N-His tag MG50526-NH
    CD99L2 cDNA ORF Clone, Mouse, C-HA tag MG50526-CY
    CD99L2 cDNA ORF Clone, Mouse, N-HA tag MG50526-NY
    CD99L2 cDNA ORF Clone, Mouse, C-Myc tag MG50526-CM
    CD99L2 cDNA ORF Clone, Mouse, N-Myc tag MG50526-NM
    CD99L2 qPCR Primer Pairs, Mouse MP200518

    CD99L2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD99L2 cDNA ORF Clone in Cloning Vector, Human HG15760-G
    CD99L2 cDNA ORF Clone, Human, untagged HG15760-UT
    CD99L2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15760-ACG
    CD99L2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15760-ACGLN
    CD99L2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15760-ACR
    CD99L2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15760-CF
    CD99L2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15760-NF
    CD99L2 cDNA ORF Clone, Human, C-His tag HG15760-CH
    CD99L2 cDNA ORF Clone, Human, N-His tag HG15760-NH
    CD99L2 cDNA ORF Clone, Human, N-HA tag HG15760-NY
    CD99L2 cDNA ORF Clone, Human, C-Myc tag HG15760-CM
    CD99L2 cDNA ORF Clone, Human, N-Myc tag HG15760-NM
    CD99L2 qPCR Primer Pairs, Human HP104352
    info info
    添加购物车成功! 添加购物车失败!