CD69 cDNA ORF Clone, Human, C-HA tag

Cat: HG11150-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD69 Reagents
CRO Services
Product recommended

All CD69 Reagents
CD69 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
642 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD69 molecule with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+0.64kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD69 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD69 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
CD69 cDNA ORF Clone, Human, C-HA tag Alternative Names
AIM cDNA ORF Clone, Human;BL-AC/P26 cDNA ORF Clone, Human;CLEC2C cDNA ORF Clone, Human;EA1 cDNA ORF Clone, Human;GP32/28 cDNA ORF Clone, Human;MLR-3 cDNA ORF Clone, Human
CD69 Background Information

Early activation antigen CD69, also known as activation inducer molecule (AIM), is a single-pass type II membrane protein. Recently, cDNA clones encoding human and mouse CD69 were isolated and showed CD69 to be a member of the C-type lectin superfamily. It is one of the earliest cell surface antigens expressed by T cells following activation. Once expressed, CD69 acts as a costimulatory molecule for T cell activation and proliferation. In addition to mature T cells, CD69 is inducibly expressed by immature thymocytes, B cells, natural killer (NK) cells, monocytes, neutrophils and eosinophils, and is constitutively expressed by mature thymocytes and platelets. CD69 is involved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, natural killer (NK) cells, and platelets. The structure, chromosomal localization, expression and function of CD69 suggest that it is likely a pleiotropic immune regulator , potentially important in the activation and differentiation of a wide variety of hematopoietic cells. This membrane molecule transiently expresses on activated lymphocytes, and its selective expression in inflammatory infiltrates suggests that it plays a role in the pathogenesis of inflammatory diseases. CD69 plays a crucial role in the pathogenesis of allergen-induced eosinophilic airway inflammation and hyperresponsiveness and that CD69 could be a possible therapeutic target for asthmatic patients.

Full Name
CD69 molecule
References
  • Ziegler SF, et al. (1994) The activation antigen CD69. Stem Cells. 12(5): 456-65.
  • Marzio R, et al. (1999) CD69 and regulation of the immune function. Immunopharmacol Immunotoxicol. 21(3): 565-82.
  • Lamana A, et al. (2006) The role of CD69 in acute neutrophil-mediated inflammation. Eur J Immunol. 36(10): 2632-8.
  • Miki-Hosokawa T, et al. (2009) CD69 controls the pathogenesis of allergic airway inflammation. J Immunol. 183(12): 8203-15.
  • CD69 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD69 cDNA ORF Clone in Cloning Vector, Rat RG80209-G
    CD69 cDNA ORF Clone, Rat, untagged RG80209-UT
    CD69 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80209-ACG
    CD69 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80209-ACGLN
    CD69 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80209-ACR
    CD69 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80209-CF
    CD69 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80209-NF
    CD69 cDNA ORF Clone, Rat, C-His tag RG80209-CH
    CD69 cDNA ORF Clone, Rat, N-His tag RG80209-NH
    CD69 cDNA ORF Clone, Rat, C-HA tag RG80209-CY
    CD69 cDNA ORF Clone, Rat, N-HA tag RG80209-NY
    CD69 cDNA ORF Clone, Rat, C-Myc tag RG80209-CM
    CD69 cDNA ORF Clone, Rat, N-Myc tag RG80209-NM
    CD69 qPCR Primer Pairs, Rat RP300201

    CD69 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD69 cDNA ORF Clone in Cloning Vector, Mouse MG50731-G
    CD69 cDNA ORF Clone, Mouse, untagged MG50731-UT
    CD69 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50731-ACG
    CD69 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50731-ACGLN
    CD69 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50731-ACR
    CD69 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50731-CF
    CD69 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50731-NF
    CD69 cDNA ORF Clone, Mouse, C-His tag MG50731-CH
    CD69 cDNA ORF Clone, Mouse, N-His tag MG50731-NH
    CD69 cDNA ORF Clone, Mouse, C-HA tag MG50731-CY
    CD69 cDNA ORF Clone, Mouse, N-HA tag MG50731-NY
    CD69 cDNA ORF Clone, Mouse, C-Myc tag MG50731-CM
    CD69 cDNA ORF Clone, Mouse, N-Myc tag MG50731-NM
    CD69 qPCR Primer Pairs, Mouse MP200706

    CD69 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD69 cDNA ORF Clone in Cloning Vector, Human HG11150-M
    CD69 cDNA ORF Clone, Human, untagged HG11150-UT
    CD69 cDNA ORF Clone, Human, C-GFPSpark® tag HG11150-ACG
    CD69 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11150-ACGLN
    CD69 cDNA ORF Clone, Human, C-OFPSpark® tag HG11150-ACR
    CD69 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11150-CF
    CD69 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11150-NF
    CD69 cDNA ORF Clone, Human, C-His tag HG11150-CH
    CD69 cDNA ORF Clone, Human, N-His tag HG11150-NH
    CD69 cDNA ORF Clone, Human, N-HA tag HG11150-NY
    CD69 cDNA ORF Clone, Human, C-Myc tag HG11150-CM
    CD69 cDNA ORF Clone, Human, N-Myc tag HG11150-NM
    CD69 qPCR Primer Pairs, Human HP101059
    info info
    添加购物车成功! 添加购物车失败!