CD5L cDNA ORF Clone, Human, N-Myc tag

Cat: HG10791-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD5L Reagents

CRO Services

Product recommended


All CD5L Reagents

CD5L cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Description
Full length Clone DNA of Human CD5 molecule-like with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD5L cDNA ORF Clone, Human, N-Myc tag Alternative Names

AIM cDNA ORF Clone, Human;API6 cDNA ORF Clone, Human;PRO229 cDNA ORF Clone, Human;SP-ALPHA cDNA ORF Clone, Human;Spalpha cDNA ORF Clone, Human

CD5L Background Information

CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor cysteine-rich (SRCR) superfamily and contains three SRCR domains. It is a secreted glycoprotein and expressed by macrophages presentin lymphoid tissues (spleen, lymph node, thymus, and bone marrow). It binds to myelomonocytic and lymphoid cells and may play an important role in the regulation of the innate and adaptive immune systems. CD5L functions as a pattern recognition molecule by binding both lipoteichoic acid (LTA) on Gram positive and lipopolysaccharide (LPS) on Gram negative bacteria. and the SRCR domain 1 of CD5L retains both the LPS and LTA binding activities. In addtion, it is revealed that CD5L seems to play a role as an inhibitor of apoptosis.

Full Name
CD5 molecule-like
References
  • Resnick, D. et al., 1994, Trends Biochem. Sci. 19: 5-8.
  • Gebe, J. A. et al., 1997, J. Biol. Chem. 272 (10): 6151–6158.
  • Sarrias, M.R. et al., 2004, Crit. Rev. Immunol. 24: 1-37.
  • Mukhopadhyay, S. and Gordon, S., 2004, Immunobiology 209: 39-49.
  • Sarrias, M. R. et al.,2005, J. Biol. Chem. 280 (42): 35391–35398.
  • CD5L cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD5L cDNA ORF Clone in Cloning Vector, Mouse MG50020-M
    CD5L cDNA ORF Clone, Mouse, untagged MG50020-UT
    CD5L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50020-ACGLN
    CD5L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50020-ACG
    CD5L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50020-ACR
    CD5L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50020-CF
    CD5L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50020-NF
    CD5L cDNA ORF Clone, Mouse, C-His tag MG50020-CH
    CD5L cDNA ORF Clone, Mouse, N-His tag MG50020-NH
    CD5L cDNA ORF Clone, Mouse, C-HA tag MG50020-CY
    CD5L cDNA ORF Clone, Mouse, N-HA tag MG50020-NY
    CD5L cDNA ORF Clone, Mouse, C-Myc tag MG50020-CM
    CD5L cDNA ORF Clone, Mouse, N-Myc tag MG50020-NM
    CD5L qPCR Primer Pairs, Mouse MP200020

    CD5L cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD5L cDNA ORF Clone in Cloning Vector, Human HG10791-M
    CD5L cDNA ORF Clone, Human, untagged HG10791-UT
    CD5L cDNA ORF Clone, Human, C-GFPSpark® tag HG10791-ACG
    CD5L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10791-ACGLN
    CD5L cDNA ORF Clone, Human, C-OFPSpark® tag HG10791-ACR
    CD5L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10791-CF
    CD5L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10791-NF
    CD5L cDNA ORF Clone, Human, C-His tag HG10791-CH
    CD5L cDNA ORF Clone, Human, N-His tag HG10791-NH
    CD5L cDNA ORF Clone, Human, C-HA tag HG10791-CY
    CD5L cDNA ORF Clone, Human, N-HA tag HG10791-NY
    CD5L cDNA ORF Clone, Human, C-Myc tag HG10791-CM
    CD5L qPCR Primer Pairs, Human HP100705
    info info
    添加购物车成功! 添加购物车失败!