Aminopeptidase A cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10554-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Aminopeptidase A Reagents

CRO Services

Product recommended


All Aminopeptidase A Reagents

Aminopeptidase A cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2874 bp
Description
Full length Clone DNA of Human glutamyl aminopeptidase (aminopeptidase A) with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aminopeptidase A cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

APA cDNA ORF Clone, Human;CD249 cDNA ORF Clone, Human;ENPEP cDNA ORF Clone, Human;gp160 cDNA ORF Clone, Human

Aminopeptidase A Background Information

ENPEP, also known as aminopeptidase A, is a member of the peptidase M1 family. Members of this family are involved in response to cadmium ion and proteolysis. They located in 6 components and are expressed in 26 plant structures. ENPEP is expressed by epithelial cells of the proximal tubule cells and the glomerulus of the nephron. It also can be detected in a variety of other tissues. ENPEP probably plays a role in regulating growth and differentiation of early B-lineage cells. It also may play a role in the catabolic pathway of the renin-angiotensin system. ENPEP is a zinc-dependent membrane-bound aminopeptidase that catalyzes the cleavage of glutamatic and aspartatic amino acid residues from the N-terminus of polypeptides. It degrades vasoconstricting angiotensin II into angiotensin III and therefore helps to regulate blood pressure.

Full Name
glutamyl aminopeptidase
References
  • Speth RC, et al. (2008) The significance of brain aminopeptidases in the regulation of the actions of angiotensin peptides in the brain. Heart Fail Rev. 13(3):299-309.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Pérez I, et al. (2009) Increased APN/CD13 and acid aminopeptidase activities in head and neck squamous cell carcinoma. Head Neck. 31(10):1335-40.
  • Aminopeptidase A cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Aminopeptidase A cDNA ORF Clone in Cloning Vector, Rhesus CG90260-G
    Aminopeptidase A cDNA ORF Clone, Rhesus, untagged CG90260-UT
    Aminopeptidase A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90260-ACG
    Aminopeptidase A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90260-ACGLN
    Aminopeptidase A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90260-ACR
    Aminopeptidase A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90260-CF
    Aminopeptidase A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90260-NF
    Aminopeptidase A cDNA ORF Clone, Rhesus, C-His tag CG90260-CH
    Aminopeptidase A cDNA ORF Clone, Rhesus, N-His tag CG90260-NH
    Aminopeptidase A cDNA ORF Clone, Rhesus, C-HA tag CG90260-CY
    Aminopeptidase A cDNA ORF Clone, Rhesus, N-HA tag CG90260-NY
    Aminopeptidase A cDNA ORF Clone, Rhesus, C-Myc tag CG90260-CM
    Aminopeptidase A cDNA ORF Clone, Rhesus, N-Myc tag CG90260-NM

    Aminopeptidase A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Aminopeptidase A cDNA ORF Clone in Cloning Vector, Rat RG80387-G
    Aminopeptidase A cDNA ORF Clone, Rat, untagged RG80387-UT
    Aminopeptidase A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80387-ACG
    Aminopeptidase A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80387-ACGLN
    Aminopeptidase A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80387-ACR
    Aminopeptidase A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80387-CF
    Aminopeptidase A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80387-NF
    Aminopeptidase A cDNA ORF Clone, Rat, C-His tag RG80387-CH
    Aminopeptidase A cDNA ORF Clone, Rat, N-His tag RG80387-NH
    Aminopeptidase A cDNA ORF Clone, Rat, C-HA tag RG80387-CY
    Aminopeptidase A cDNA ORF Clone, Rat, N-HA tag RG80387-NY
    Aminopeptidase A cDNA ORF Clone, Rat, C-Myc tag RG80387-CM
    Aminopeptidase A cDNA ORF Clone, Rat, N-Myc tag RG80387-NM
    Aminopeptidase A qPCR Primer Pairs, Rat RP300353

    Aminopeptidase A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Aminopeptidase A cDNA ORF Clone in Cloning Vector, Mouse MG50082-M
    Aminopeptidase A cDNA ORF Clone, Mouse, untagged MG50082-UT
    Aminopeptidase A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50082-ACG
    Aminopeptidase A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50082-ACGLN
    Aminopeptidase A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50082-ACR
    Aminopeptidase A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50082-CF
    Aminopeptidase A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50082-NF
    Aminopeptidase A cDNA ORF Clone, Mouse, C-His tag MG50082-CH
    Aminopeptidase A cDNA ORF Clone, Mouse, N-His tag MG50082-NH
    Aminopeptidase A cDNA ORF Clone, Mouse, C-HA tag MG50082-CY
    Aminopeptidase A cDNA ORF Clone, Mouse, N-HA tag MG50082-NY
    Aminopeptidase A cDNA ORF Clone, Mouse, C-Myc tag MG50082-CM
    Aminopeptidase A cDNA ORF Clone, Mouse, N-Myc tag MG50082-NM
    Aminopeptidase A qPCR Primer Pairs, Mouse MP200112

    Aminopeptidase A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Aminopeptidase A cDNA ORF Clone in Cloning Vector, Human HG10554-M
    Aminopeptidase A cDNA ORF Clone, Human, untagged HG10554-UT
    Aminopeptidase A cDNA ORF Clone, Human, C-GFPSpark® tag HG10554-ACG
    Aminopeptidase A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10554-ACGLN
    Aminopeptidase A cDNA ORF Clone, Human, C-OFPSpark® tag HG10554-ACR
    Aminopeptidase A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10554-CF
    Aminopeptidase A cDNA ORF Clone, Human, C-His tag HG10554-CH
    Aminopeptidase A cDNA ORF Clone, Human, N-His tag HG10554-NH
    Aminopeptidase A cDNA ORF Clone, Human, C-HA tag HG10554-CY
    Aminopeptidase A cDNA ORF Clone, Human, N-HA tag HG10554-NY
    Aminopeptidase A cDNA ORF Clone, Human, C-Myc tag HG10554-CM
    Aminopeptidase A cDNA ORF Clone, Human, N-Myc tag HG10554-NM
    Aminopeptidase A qPCR Primer Pairs, Human HP100567
    info info
    添加购物车成功! 添加购物车失败!