CCT7/TCP1 eta cDNA ORF Clone, Human, C-Myc tag

Cat: HG15591-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CCT7/TCP1 eta Reagents

CRO Services

Product recommended


All CCT7/TCP1 eta Reagents

CCT7/TCP1 eta cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1632 bp
Description
Full length Clone DNA of Human chaperonin containing TCP1, subunit 7 (eta) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCT7/TCP1 eta cDNA ORF Clone, Human, C-Myc tag Alternative Names

CCTETA cDNA ORF Clone, Human;CCTH cDNA ORF Clone, Human;NIP7-1 cDNA ORF Clone, Human;TCP1ETA cDNA ORF Clone, Human

CCT7/TCP1 eta Background Information

Full Name
chaperonin containing TCP1, subunit 7 (eta)

CCT7/TCP1 eta cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCT7/TCP1 eta cDNA ORF Clone in Cloning Vector, Rat RG87176-U
CCT7/TCP1 eta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87176-ACGLN

CCT7/TCP1 eta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCT7/TCP1 eta cDNA ORF Clone in Cloning Vector, Mouse MG51801-G
CCT7/TCP1 eta cDNA ORF Clone, Mouse, untagged MG51801-UT
CCT7/TCP1 eta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51801-ACG
CCT7/TCP1 eta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51801-ACGLN
CCT7/TCP1 eta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51801-ANG
CCT7/TCP1 eta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51801-ACR
CCT7/TCP1 eta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51801-ANR
CCT7/TCP1 eta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51801-CF
CCT7/TCP1 eta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51801-NF
CCT7/TCP1 eta cDNA ORF Clone, Mouse, C-His tag MG51801-CH
CCT7/TCP1 eta cDNA ORF Clone, Mouse, N-His tag MG51801-NH
CCT7/TCP1 eta cDNA ORF Clone, Mouse, C-HA tag MG51801-CY
CCT7/TCP1 eta cDNA ORF Clone, Mouse, N-HA tag MG51801-NY
CCT7/TCP1 eta cDNA ORF Clone, Mouse, C-Myc tag MG51801-CM
CCT7/TCP1 eta cDNA ORF Clone, Mouse, N-Myc tag MG51801-NM
CCT7/TCP1 eta qPCR Primer Pairs, Mouse MP201674

CCT7/TCP1 eta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCT7/TCP1 eta cDNA ORF Clone in Cloning Vector, Human HG15591-G
CCT7/TCP1 eta cDNA ORF Clone, Human, untagged HG15591-UT
CCT7/TCP1 eta cDNA ORF Clone, Human, C-GFPSpark® tag HG15591-ACG
CCT7/TCP1 eta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15591-ACGLN
CCT7/TCP1 eta cDNA ORF Clone, Human, N-GFPSpark® tag HG15591-ANG
CCT7/TCP1 eta cDNA ORF Clone, Human, C-OFPSpark® tag HG15591-ACR
CCT7/TCP1 eta cDNA ORF Clone, Human, N-OFPSpark® tag HG15591-ANR
CCT7/TCP1 eta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15591-CF
CCT7/TCP1 eta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15591-NF
CCT7/TCP1 eta cDNA ORF Clone, Human, C-His tag HG15591-CH
CCT7/TCP1 eta cDNA ORF Clone, Human, N-His tag HG15591-NH
CCT7/TCP1 eta cDNA ORF Clone, Human, C-HA tag HG15591-CY
CCT7/TCP1 eta cDNA ORF Clone, Human, N-HA tag HG15591-NY
CCT7/TCP1 eta cDNA ORF Clone, Human, N-Myc tag HG15591-NM
CCT7/TCP1 eta qPCR Primer Pairs, Human HP104211
info info
添加购物车成功! 添加购物车失败!