CCBL2/KYAT3 cDNA ORF Clone, Human, N-HA tag

Cat: HG14628-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CCBL2/KYAT3 Reagents

CRO Services

Product recommended


All CCBL2/KYAT3 Reagents

CCBL2/KYAT3 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
873 bp
Description
Full length Clone DNA of Human cysteine conjugate-beta lyase 2 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCBL2/KYAT3 cDNA ORF Clone, Human, N-HA tag Alternative Names

KAT3 cDNA ORF Clone, Human;KATIII cDNA ORF Clone, Human;KYAT3 cDNA ORF Clone, Human

CCBL2/KYAT3 Background Information

Full Name
cysteine conjugate-beta lyase 2

CCBL2/KYAT3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCBL2/KYAT3 cDNA ORF Clone in Cloning Vector, Mouse MG53158-G
CCBL2/KYAT3 cDNA ORF Clone, Mouse, untagged MG53158-UT
CCBL2/KYAT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53158-ACG
CCBL2/KYAT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53158-ACGLN
CCBL2/KYAT3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53158-ANG
CCBL2/KYAT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53158-ACR
CCBL2/KYAT3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53158-ANR
CCBL2/KYAT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53158-CF
CCBL2/KYAT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53158-NF
CCBL2/KYAT3 cDNA ORF Clone, Mouse, C-His tag MG53158-CH
CCBL2/KYAT3 cDNA ORF Clone, Mouse, N-His tag MG53158-NH
CCBL2/KYAT3 cDNA ORF Clone, Mouse, C-HA tag MG53158-CY
CCBL2/KYAT3 cDNA ORF Clone, Mouse, N-HA tag MG53158-NY
CCBL2/KYAT3 cDNA ORF Clone, Mouse, C-Myc tag MG53158-CM
CCBL2/KYAT3 cDNA ORF Clone, Mouse, N-Myc tag MG53158-NM

CCBL2/KYAT3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCBL2/KYAT3 cDNA ORF Clone in Cloning Vector, Human HG29685-U
CCBL2/KYAT3 cDNA ORF Clone in Cloning Vector, Human HG14628-G
CCBL2/KYAT3 cDNA ORF Clone, Human, untagged HG14628-UT
CCBL2/KYAT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29685-ACGLN
CCBL2/KYAT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14628-ACG
CCBL2/KYAT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14628-ACGLN
CCBL2/KYAT3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14628-ANG
CCBL2/KYAT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14628-ACR
CCBL2/KYAT3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14628-ANR
CCBL2/KYAT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14628-CF
CCBL2/KYAT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14628-NF
CCBL2/KYAT3 cDNA ORF Clone, Human, C-His tag HG14628-CH
CCBL2/KYAT3 cDNA ORF Clone, Human, N-His tag HG14628-NH
CCBL2/KYAT3 cDNA ORF Clone, Human, C-HA tag HG14628-CY
CCBL2/KYAT3 cDNA ORF Clone, Human, C-Myc tag HG14628-CM
CCBL2/KYAT3 cDNA ORF Clone, Human, N-Myc tag HG14628-NM
CCBL2/KYAT3 qPCR Primer Pairs, Human HP103262
info info
添加购物车成功! 添加购物车失败!