Catalase cDNA ORF Clone, Human, N-HA tag

Cat: HG12084-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Catalase Reagents
CRO Services
Product recommended

All Catalase Reagents
Catalase cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1584 bp
Description
Full length Clone DNA of Human catalase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Catalase Background Information

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

Full Name
catalase
References
  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Catalase cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Catalase cDNA ORF Clone in Cloning Vector, Ferret FG60113-G
    Catalase cDNA ORF Clone, Ferret, untagged FG60113-UT
    Catalase cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60113-ACG
    Catalase Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60113-ACGLN
    Catalase cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60113-ACR
    Catalase cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60113-CF
    Catalase cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60113-NF
    Catalase cDNA ORF Clone, Ferret, C-His tag FG60113-CH
    Catalase cDNA ORF Clone, Ferret, N-His tag FG60113-NH
    Catalase cDNA ORF Clone, Ferret, C-HA tag FG60113-CY
    Catalase cDNA ORF Clone, Ferret, N-HA tag FG60113-NY
    Catalase cDNA ORF Clone, Ferret, C-Myc tag FG60113-CM
    Catalase cDNA ORF Clone, Ferret, N-Myc tag FG60113-NM

    Catalase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Catalase cDNA ORF Clone in Cloning Vector, Rat RG81845-U
    Catalase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81845-ACGLN

    Catalase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Catalase cDNA ORF Clone in Cloning Vector, Mouse MG51898-G
    Catalase cDNA ORF Clone, Mouse, untagged MG51898-UT
    Catalase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51898-ACGLN
    Catalase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51898-ACG
    Catalase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51898-ANG
    Catalase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51898-ACR
    Catalase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51898-ANR
    Catalase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51898-CF
    Catalase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51898-NF
    Catalase cDNA ORF Clone, Mouse, C-His tag MG51898-CH
    Catalase cDNA ORF Clone, Mouse, N-His tag MG51898-NH
    Catalase cDNA ORF Clone, Mouse, C-HA tag MG51898-CY
    Catalase cDNA ORF Clone, Mouse, N-HA tag MG51898-NY
    Catalase cDNA ORF Clone, Mouse, C-Myc tag MG51898-CM
    Catalase cDNA ORF Clone, Mouse, N-Myc tag MG51898-NM
    Catalase qPCR Primer Pairs, Mouse MP201771

    Catalase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Catalase cDNA ORF Clone in Cloning Vector, Human HG12084-G
    Catalase cDNA ORF Clone, Human, untagged HG12084-UT
    Catalase cDNA ORF Clone, Human, C-GFPSpark® tag HG12084-ACG
    Catalase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12084-ACGLN
    Catalase cDNA ORF Clone, Human, N-GFPSpark® tag HG12084-ANG
    Catalase cDNA ORF Clone, Human, C-OFPSpark® tag HG12084-ACR
    Catalase cDNA ORF Clone, Human, N-OFPSpark® tag HG12084-ANR
    Catalase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12084-CF
    Catalase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12084-NF
    Catalase cDNA ORF Clone, Human, C-His tag HG12084-CH
    Catalase cDNA ORF Clone, Human, N-His tag HG12084-NH
    Catalase cDNA ORF Clone, Human, C-HA tag HG12084-CY
    Catalase cDNA ORF Clone, Human, C-Myc tag HG12084-CM
    Catalase cDNA ORF Clone, Human, N-Myc tag HG12084-NM
    Catalase qPCR Primer Pairs, Human HP101612
    info info
    添加购物车成功! 添加购物车失败!