CAPZA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11631-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CAPZA1 Reagents

CRO Services

Product recommended


All CAPZA1 Reagents

CAPZA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
861 bp
Description
Full length Clone DNA of Human capping protein (actin filament) muscle Z-line, alpha 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAPZA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

CAPPA1 cDNA ORF Clone, Human;CAPZ cDNA ORF Clone, Human;CAZ1 cDNA ORF Clone, Human

CAPZA1 Background Information

Full Name
capping protein (actin filament) muscle Z-line, alpha 1

CAPZA1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
CAPZA1 cDNA ORF Clone in Cloning Vector, Canine DG70230-U
CAPZA1 cDNA ORF Clone, Canine, untagged DG70230-UT
CAPZA1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70230-ACG
CAPZA1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70230-ACGLN
CAPZA1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70230-ANG
CAPZA1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70230-ACR
CAPZA1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70230-ANR
CAPZA1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70230-CF
CAPZA1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70230-NF
CAPZA1 cDNA ORF Clone, Canine, C-His tag DG70230-CH
CAPZA1 cDNA ORF Clone, Canine, N-His tag DG70230-NH
CAPZA1 cDNA ORF Clone, Canine, C-HA tag DG70230-CY
CAPZA1 cDNA ORF Clone, Canine, N-HA tag DG70230-NY
CAPZA1 cDNA ORF Clone, Canine, C-Myc tag DG70230-CM
CAPZA1 cDNA ORF Clone, Canine, N-Myc tag DG70230-NM

CAPZA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CAPZA1 cDNA ORF Clone in Cloning Vector, Rat RG81375-G

CAPZA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CAPZA1 cDNA ORF Clone in Cloning Vector, Mouse MG52764-G
CAPZA1 cDNA ORF Clone, Mouse, untagged MG52764-UT
CAPZA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52764-ACG
CAPZA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52764-ACGLN
CAPZA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52764-ANG
CAPZA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52764-ACR
CAPZA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52764-ANR
CAPZA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52764-CF
CAPZA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52764-NF
CAPZA1 cDNA ORF Clone, Mouse, C-His tag MG52764-CH
CAPZA1 cDNA ORF Clone, Mouse, N-His tag MG52764-NH
CAPZA1 cDNA ORF Clone, Mouse, C-HA tag MG52764-CY
CAPZA1 cDNA ORF Clone, Mouse, N-HA tag MG52764-NY
CAPZA1 cDNA ORF Clone, Mouse, C-Myc tag MG52764-CM
CAPZA1 cDNA ORF Clone, Mouse, N-Myc tag MG52764-NM

CAPZA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CAPZA1 cDNA ORF Clone in Cloning Vector, Human HG11631-M
CAPZA1 cDNA ORF Clone, Human, untagged HG11631-UT
CAPZA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11631-ACGLN
CAPZA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11631-ACG
CAPZA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11631-ANG
CAPZA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11631-ACR
CAPZA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11631-ANR
CAPZA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11631-NF
CAPZA1 cDNA ORF Clone, Human, C-His tag HG11631-CH
CAPZA1 cDNA ORF Clone, Human, N-His tag HG11631-NH
CAPZA1 cDNA ORF Clone, Human, C-HA tag HG11631-CY
CAPZA1 cDNA ORF Clone, Human, N-HA tag HG11631-NY
CAPZA1 cDNA ORF Clone, Human, C-Myc tag HG11631-CM
CAPZA1 cDNA ORF Clone, Human, N-Myc tag HG11631-NM
CAPZA1 qPCR Primer Pairs, Human HP101483
info info
添加购物车成功! 添加购物车失败!