CA13 cDNA ORF Clone, Human, C-His tag

Cat: HG10461-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CA13 Reagents
CRO Services
Product recommended

All CA13 Reagents
CA13 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
789 bp
Description
Full length Clone DNA of Human carbonic anhydrase XIII with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CA13 cDNA ORF Clone, Human, C-His tag Alternative Names
CAXIII cDNA ORF Clone, Human;FLJ37995 cDNA ORF Clone, Human;MGC59868 cDNA ORF Clone, Human
CA13 Background Information

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

Full Name
carbonic anhydrase XIII
References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • CA13 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CA13 cDNA ORF Clone in Cloning Vector, Rat RG80088-G
    CA13 cDNA ORF Clone, Rat, untagged RG80088-UT
    CA13 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80088-ACG
    CA13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80088-ACGLN
    CA13 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80088-ANG
    CA13 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80088-ACR
    CA13 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80088-ANR
    CA13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80088-CF
    CA13 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80088-NF
    CA13 cDNA ORF Clone, Rat, C-His tag RG80088-CH
    CA13 cDNA ORF Clone, Rat, N-His tag RG80088-NH
    CA13 cDNA ORF Clone, Rat, C-HA tag RG80088-CY
    CA13 cDNA ORF Clone, Rat, N-HA tag RG80088-NY
    CA13 cDNA ORF Clone, Rat, C-Myc tag RG80088-CM
    CA13 cDNA ORF Clone, Rat, N-Myc tag RG80088-NM
    CA13 qPCR Primer Pairs, Rat RP300084

    CA13 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CA13 cDNA ORF Clone in Cloning Vector, Human HG10461-M
    CA13 cDNA ORF Clone, Human, untagged HG10461-UT
    CA13 cDNA ORF Clone, Human, C-GFPSpark® tag HG10461-ACG
    CA13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10461-ACGLN
    CA13 cDNA ORF Clone, Human, N-GFPSpark® tag HG10461-ANG
    CA13 cDNA ORF Clone, Human, C-OFPSpark® tag HG10461-ACR
    CA13 cDNA ORF Clone, Human, N-OFPSpark® tag HG10461-ANR
    CA13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10461-CF
    CA13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10461-NF
    CA13 cDNA ORF Clone, Human, N-His tag HG10461-NH
    CA13 cDNA ORF Clone, Human, C-HA tag HG10461-CY
    CA13 cDNA ORF Clone, Human, N-HA tag HG10461-NY
    CA13 cDNA ORF Clone, Human, C-Myc tag HG10461-CM
    CA13 cDNA ORF Clone, Human, N-Myc tag HG10461-NM
    CA13 qPCR Primer Pairs, Human HP100489
    info info
    添加购物车成功! 添加购物车失败!