BMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10609-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BMP4 Reagents
CRO Services
Product recommended

All BMP4 Reagents
BMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human bone morphogenetic protein 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.27kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
BMP4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human BMP-4/BMP-2B Gene Expression validated Image 14296
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
BMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
BMP2B cDNA ORF Clone, Human;BMP2B1 cDNA ORF Clone, Human;MCOPS6 cDNA ORF Clone, Human;OFC11 cDNA ORF Clone, Human;ZYME cDNA ORF Clone, Human
BMP4 Background Information
Full Name
bone morphogenetic protein 4

BMP4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Rhesus CG90038-G
BMP4 cDNA ORF Clone, Rhesus, untagged CG90038-UT
BMP4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90038-ACG
BMP4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90038-ACGLN
BMP4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90038-ACR
BMP4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90038-CF
BMP4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90038-NF
BMP4 cDNA ORF Clone, Rhesus, C-His tag CG90038-CH
BMP4 cDNA ORF Clone, Rhesus, N-His tag CG90038-NH
BMP4 cDNA ORF Clone, Rhesus, C-HA tag CG90038-CY
BMP4 cDNA ORF Clone, Rhesus, N-HA tag CG90038-NY
BMP4 cDNA ORF Clone, Rhesus, C-Myc tag CG90038-CM
BMP4 cDNA ORF Clone, Rhesus, N-Myc tag CG90038-NM

BMP4 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Canine DG70074-G
BMP4 cDNA ORF Clone, Canine, untagged DG70074-UT
BMP4 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70074-ACG
BMP4 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70074-ACGLN
BMP4 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70074-ACR
BMP4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70074-CF
BMP4 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70074-NF
BMP4 cDNA ORF Clone, Canine, C-His tag DG70074-CH
BMP4 cDNA ORF Clone, Canine, N-His tag DG70074-NH
BMP4 cDNA ORF Clone, Canine, C-HA tag DG70074-CY
BMP4 cDNA ORF Clone, Canine, N-HA tag DG70074-NY
BMP4 cDNA ORF Clone, Canine, C-Myc tag DG70074-CM
BMP4 cDNA ORF Clone, Canine, N-Myc tag DG70074-NM

BMP4 cDNA ORF Clone, Danio rerio (zebrafish), Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Danio rerio (zebrafish) ZG63001-G
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), untagged ZG63001-UT
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-GFPSpark® tag ZG63001-ACG
BMP4 Lentiviral cDNA ORF Clone, Danio rerio (zebrafish), C-GFPSpark® tag ZG63001-ACGLN
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-OFPSpark® tag ZG63001-ACR
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-DDK (Flag®) tag ZG63001-CF
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-DDK (Flag®) tag ZG63001-NF
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-His tag ZG63001-CH
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-His tag ZG63001-NH
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-HA tag ZG63001-CY
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-HA tag ZG63001-NY
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-Myc tag ZG63001-CM
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-Myc tag ZG63001-NM

BMP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Mouse MG50439-G
BMP4 cDNA ORF Clone, Mouse, untagged MG50439-UT
BMP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50439-ACGLN
BMP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50439-ACG
BMP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50439-ACR
BMP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50439-G-F
BMP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50439-CF
BMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50439-NF
BMP4 cDNA ORF Clone, Mouse, C-His tag MG50439-CH
BMP4 cDNA ORF Clone, Mouse, N-His tag MG50439-NH
BMP4 cDNA ORF Clone, Mouse, C-HA tag MG50439-CY
BMP4 cDNA ORF Clone, Mouse, N-HA tag MG50439-NY
BMP4 cDNA ORF Clone, Mouse, C-Myc tag MG50439-CM
BMP4 cDNA ORF Clone, Mouse, N-Myc tag MG50439-NM
BMP4 qPCR Primer Pairs, Mouse MP200448

BMP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Human HG10609-G
BMP4 cDNA ORF Clone, Human, untagged HG10609-UT
BMP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10609-ACG
BMP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10609-ACGLN
BMP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10609-ACR
BMP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10609-NF
BMP4 cDNA ORF Clone, Human, C-His tag HG10609-CH
BMP4 cDNA ORF Clone, Human, N-His tag HG10609-NH
BMP4 cDNA ORF Clone, Human, C-HA tag HG10609-CY
BMP4 cDNA ORF Clone, Human, N-HA tag HG10609-NY
BMP4 cDNA ORF Clone, Human, C-Myc tag HG10609-CM
BMP4 cDNA ORF Clone, Human, N-Myc tag HG10609-NM
BMP4 qPCR Primer Pairs, Human HP100595
info info
添加购物车成功! 添加购物车失败!