Apolipoprotein H cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11221-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Apolipoprotein H Reagents

CRO Services

Product recommended


All Apolipoprotein H Reagents

Apolipoprotein H cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human apolipoprotein H (beta-2-glycoprotein I) with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.07kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Apolipoprotein H cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Apolipoprotein H cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614

Apolipoprotein H cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

B2G1 cDNA ORF Clone, Human;B2GP1 cDNA ORF Clone, Human;BG cDNA ORF Clone, Human

Apolipoprotein H Background Information

Apolipoprotein H (APOH), also known as Beta-2-glycoprotein 1, Activated protein C-binding protein, B2GPI, and B2G1, is a glycoprotein synthesized by liver cells and it is present in the blood associated with plasma lipoproteins. It is an essential cofactor for the binding of certain antiphospholipid antibodies (APA) to anionic phospholipid. APOH binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. APOH may prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells. APOH appears to completely inhibit serotonin release by the platelets and prevents subsequent waves of the ADP-induced aggregation. The activity of APOH appears to involve the binding of agglutenating, negatively charged compounds, and inhibits agglutenation by the contact activation of the intrinsic blood coagulation pathway. APOH causes a reduction of the prothrombinase binding sites on platelets and reduces the activation caused by collagen when thrombin is present at physiological serum concentrations of APOH suggesting a regulatory role of APOH in coagulation. APOH plasma concentrations are strongly associated to metabolic syndrome alterations and vascular disease in type 2 diabetic and could be considered as a clinical marker of cardiovascular risk. APOH is found on several classes of lipoproteins, and is involved in the activation of lipoprotein lipase in lipid metabolism. This single-chain glycoprotein also has been implicated in several physiologic pathways including coagulation and the production of hypertension, which are related to the pathogenesis of primary cerebral hemorrhage (PICH).

Full Name
apolipoprotein H (beta-2-glycoprotein I)
References
  • Kamboh MI, et al. (1998) Genetics of apolipoprotein H (beta2-glycoprotein I) and anionic phospholipid binding. Lupus. 7 Suppl 2: S10-3.
  • Singh P, et al. (2002) Genetics of apolipoprotein H (beta2-glycoprotein I) polymorphism in India. Ann Hum Biol. 29(3): 247-55.
  • Xia J, et al. (2004) Apolipoprotein H gene polymorphisms and risk of primary cerebral hemorrhage in a Chinese population. Cerebrovasc Dis. 17(2-3): 197-203.
  • Chen Q, et al. (2006) Complete DNA sequence variation in the apolipoprotein H (beta-glycoprotein I) gene and identification of informative SNPs. Ann Hum Genet. 70(Pt 1): 1-11.
  • Leduc MS, et al. (2008) Comprehensive evaluation of apolipoprotein H gene (APOH) variation identifies novel associations with measures of lipid metabolism in GENOA. J Lipid Res. 49(12): 2648-56.
  • Apolipoprotein H cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein H cDNA ORF Clone in Cloning Vector, Rat RG80701-U
    Apolipoprotein H cDNA ORF Clone, Rat, untagged RG80701-UT
    Apolipoprotein H cDNA ORF Clone, Rat, C-GFPSpark® tag RG80701-ACG
    Apolipoprotein H Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80701-ACGLN
    Apolipoprotein H cDNA ORF Clone, Rat, C-OFPSpark® tag RG80701-ACR
    Apolipoprotein H cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80701-CF
    Apolipoprotein H cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80701-NF
    Apolipoprotein H cDNA ORF Clone, Rat, C-His tag RG80701-CH
    Apolipoprotein H cDNA ORF Clone, Rat, N-His tag RG80701-NH
    Apolipoprotein H cDNA ORF Clone, Rat, C-HA tag RG80701-CY
    Apolipoprotein H cDNA ORF Clone, Rat, N-HA tag RG80701-NY
    Apolipoprotein H cDNA ORF Clone, Rat, C-Myc tag RG80701-CM
    Apolipoprotein H cDNA ORF Clone, Rat, N-Myc tag RG80701-NM
    Apolipoprotein H qPCR Primer Pairs, Rat RP300665

    Apolipoprotein H cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein H cDNA ORF Clone in Cloning Vector, Mouse MG50928-G
    Apolipoprotein H cDNA ORF Clone, Mouse, untagged MG50928-UT
    Apolipoprotein H cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50928-ACG
    Apolipoprotein H Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50928-ACGLN
    Apolipoprotein H cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50928-ACR
    Apolipoprotein H cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50928-CF
    Apolipoprotein H cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50928-NF
    Apolipoprotein H cDNA ORF Clone, Mouse, C-His tag MG50928-CH
    Apolipoprotein H cDNA ORF Clone, Mouse, N-His tag MG50928-NH
    Apolipoprotein H cDNA ORF Clone, Mouse, C-HA tag MG50928-CY
    Apolipoprotein H cDNA ORF Clone, Mouse, N-HA tag MG50928-NY
    Apolipoprotein H cDNA ORF Clone, Mouse, C-Myc tag MG50928-CM
    Apolipoprotein H cDNA ORF Clone, Mouse, N-Myc tag MG50928-NM
    Apolipoprotein H qPCR Primer Pairs, Mouse MP200897

    Apolipoprotein H cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein H cDNA ORF Clone in Cloning Vector, Human HG11221-M
    Apolipoprotein H cDNA ORF Clone, Human, untagged HG11221-UT
    Apolipoprotein H cDNA ORF Clone, Human, C-GFPSpark® tag HG11221-ACG
    Apolipoprotein H Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11221-ACGLN
    Apolipoprotein H cDNA ORF Clone, Human, C-OFPSpark® tag HG11221-ACR
    Apolipoprotein H cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11221-CF
    Apolipoprotein H cDNA ORF Clone, Human, C-His tag HG11221-CH
    Apolipoprotein H cDNA ORF Clone, Human, N-His tag HG11221-NH
    Apolipoprotein H cDNA ORF Clone, Human, C-HA tag HG11221-CY
    Apolipoprotein H cDNA ORF Clone, Human, N-HA tag HG11221-NY
    Apolipoprotein H cDNA ORF Clone, Human, C-Myc tag HG11221-CM
    Apolipoprotein H cDNA ORF Clone, Human, N-Myc tag HG11221-NM
    Apolipoprotein H qPCR Primer Pairs, Human HP101122
    info info
    添加购物车成功! 添加购物车失败!