pro renin receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11244-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All pro renin receptor Reagents
CRO Services
Product recommended

All pro renin receptor Reagents
pro renin receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Human ATPase, H+ transporting, lysosomal accessory protein 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

pro renin receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
APT6M8-9 cDNA ORF Clone, Human;ATP6IP2 cDNA ORF Clone, Human;ATP6M8-9 cDNA ORF Clone, Human;ELDF10 cDNA ORF Clone, Human;HT028 cDNA ORF Clone, Human;M8-9 cDNA ORF Clone, Human;MRXE cDNA ORF Clone, Human;MRXSH cDNA ORF Clone, Human;MSTP009 cDNA ORF Clone, Human;PRR cDNA ORF Clone, Human;RENR cDNA ORF Clone, Human;XMRE cDNA ORF Clone, Human;XPDS cDNA ORF Clone, Human
pro renin receptor Background Information
Full Name
ATPase, H+ transporting, lysosomal accessory protein 2

pro renin receptor cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
pro renin receptor cDNA ORF Clone in Cloning Vector, Rat RG82722-U
pro renin receptor Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82722-ACGLN

pro renin receptor cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
pro renin receptor cDNA ORF Clone in Cloning Vector, Mouse MG51375-U
pro renin receptor cDNA ORF Clone, Mouse, untagged MG51375-UT
pro renin receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51375-ACGLN
pro renin receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51375-ACG
pro renin receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51375-ACR
pro renin receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51375-CF
pro renin receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51375-NF
pro renin receptor cDNA ORF Clone, Mouse, C-His tag MG51375-CH
pro renin receptor cDNA ORF Clone, Mouse, N-His tag MG51375-NH
pro renin receptor cDNA ORF Clone, Mouse, C-HA tag MG51375-CY
pro renin receptor cDNA ORF Clone, Mouse, N-HA tag MG51375-NY
pro renin receptor cDNA ORF Clone, Mouse, C-Myc tag MG51375-CM
pro renin receptor cDNA ORF Clone, Mouse, N-Myc tag MG51375-NM
pro renin receptor qPCR Primer Pairs, Mouse MP201248

pro renin receptor cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
pro renin receptor cDNA ORF Clone in Cloning Vector, Human HG11244-M
pro renin receptor cDNA ORF Clone, Human, untagged HG11244-UT
pro renin receptor cDNA ORF Clone, Human, C-GFPSpark® tag HG11244-ACG
pro renin receptor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11244-ACGLN
pro renin receptor cDNA ORF Clone, Human, C-OFPSpark® tag HG11244-ACR
pro renin receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11244-CF
pro renin receptor cDNA ORF Clone, Human, C-His tag HG11244-CH
pro renin receptor cDNA ORF Clone, Human, N-His tag HG11244-NH
pro renin receptor cDNA ORF Clone, Human, C-HA tag HG11244-CY
pro renin receptor cDNA ORF Clone, Human, N-HA tag HG11244-NY
pro renin receptor cDNA ORF Clone, Human, C-Myc tag HG11244-CM
pro renin receptor cDNA ORF Clone, Human, N-Myc tag HG11244-NM
pro renin receptor qPCR Primer Pairs, Human HP101188
info info
添加购物车成功! 添加购物车失败!