ATOX1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15594-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ATOX1 Reagents

CRO Services

Product recommended


All ATOX1 Reagents

ATOX1 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
207 bp
Description
Full length Clone DNA of Human ATX1 antioxidant protein 1 homolog (yeast) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATOX1 cDNA ORF Clone, Human, C-Myc tag Alternative Names

ATX1 cDNA ORF Clone, Human;HAH1 cDNA ORF Clone, Human

ATOX1 Background Information

Full Name
antioxidant 1 copper chaperone

ATOX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATOX1 cDNA ORF Clone in Cloning Vector, Mouse MG53364-U
ATOX1 cDNA ORF Clone, Mouse, untagged MG53364-UT
ATOX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53364-ACGLN
ATOX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53364-ACG
ATOX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53364-ANG
ATOX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53364-ACR
ATOX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53364-ANR
ATOX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53364-CF
ATOX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53364-NF
ATOX1 cDNA ORF Clone, Mouse, C-His tag MG53364-CH
ATOX1 cDNA ORF Clone, Mouse, N-His tag MG53364-NH
ATOX1 cDNA ORF Clone, Mouse, C-HA tag MG53364-CY
ATOX1 cDNA ORF Clone, Mouse, N-HA tag MG53364-NY
ATOX1 cDNA ORF Clone, Mouse, C-Myc tag MG53364-CM
ATOX1 cDNA ORF Clone, Mouse, N-Myc tag MG53364-NM

ATOX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATOX1 cDNA ORF Clone in Cloning Vector, Human HG15594-G
ATOX1 cDNA ORF Clone, Human, untagged HG15594-UT
ATOX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15594-ACGLN
ATOX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15594-ACG
ATOX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15594-ANG
ATOX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15594-ACR
ATOX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15594-ANR
ATOX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15594-CF
ATOX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15594-G-F
ATOX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15594-NF
ATOX1 cDNA ORF Clone, Human, C-His tag HG15594-CH
ATOX1 cDNA ORF Clone, Human, N-His tag HG15594-NH
ATOX1 cDNA ORF Clone, Human, C-HA tag HG15594-CY
ATOX1 cDNA ORF Clone, Human, N-HA tag HG15594-NY
ATOX1 cDNA ORF Clone, Human, N-Myc tag HG15594-NM
ATOX1 qPCR Primer Pairs, Human HP104214
info info
添加购物车成功! 添加购物车失败!