ASS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12060-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ASS1 Reagents

CRO Services

Product recommended


All ASS1 Reagents

ASS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human argininosuccinate synthase 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.28kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ASS1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Human aFGF/FGF1 Gene Plasmid Map 5637

ASS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

ASS cDNA ORF Clone, Human;CTLN1 cDNA ORF Clone, Human

ASS1 Background Information

Full Name
argininosuccinate synthase 1

ASS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ASS1 cDNA ORF Clone in Cloning Vector, Rat RG80891-G
ASS1 cDNA ORF Clone, Rat, untagged RG80891-UT
ASS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80891-ACGLN
ASS1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80891-ACG
ASS1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80891-ANG
ASS1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80891-ACR
ASS1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80891-ANR
ASS1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80891-CF
ASS1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80891-NF
ASS1 cDNA ORF Clone, Rat, C-His tag RG80891-CH
ASS1 cDNA ORF Clone, Rat, N-His tag RG80891-NH
ASS1 cDNA ORF Clone, Rat, C-HA tag RG80891-CY
ASS1 cDNA ORF Clone, Rat, N-HA tag RG80891-NY
ASS1 cDNA ORF Clone, Rat, C-Myc tag RG80891-CM
ASS1 cDNA ORF Clone, Rat, N-Myc tag RG80891-NM
ASS1 qPCR Primer Pairs, Rat RP300855

ASS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ASS1 cDNA ORF Clone in Cloning Vector, Mouse MG59255-U
ASS1 cDNA ORF Clone, Mouse, untagged MG59255-UT
ASS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59255-ACGLN
ASS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59255-ACG
ASS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59255-ANG
ASS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59255-ACR
ASS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59255-ANR
ASS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59255-CF
ASS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59255-NF
ASS1 cDNA ORF Clone, Mouse, C-His tag MG59255-CH
ASS1 cDNA ORF Clone, Mouse, N-His tag MG59255-NH
ASS1 cDNA ORF Clone, Mouse, C-HA tag MG59255-CY
ASS1 cDNA ORF Clone, Mouse, N-HA tag MG59255-NY
ASS1 cDNA ORF Clone, Mouse, C-Myc tag MG59255-CM
ASS1 cDNA ORF Clone, Mouse, N-Myc tag MG59255-NM

ASS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ASS1 cDNA ORF Clone in Cloning Vector, Human HG12060-G
ASS1 cDNA ORF Clone, Human, untagged HG12060-UT
ASS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12060-ACG
ASS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12060-ACGLN
ASS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12060-ANG
ASS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12060-ACR
ASS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12060-ANR
ASS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12060-CF
ASS1 cDNA ORF Clone, Human, C-His tag HG12060-CH
ASS1 cDNA ORF Clone, Human, N-His tag HG12060-NH
ASS1 cDNA ORF Clone, Human, C-HA tag HG12060-CY
ASS1 cDNA ORF Clone, Human, N-HA tag HG12060-NY
ASS1 cDNA ORF Clone, Human, C-Myc tag HG12060-CM
ASS1 cDNA ORF Clone, Human, N-Myc tag HG12060-NM
ASS1 qPCR Primer Pairs, Human HP101591
info info
添加购物车成功! 添加购物车失败!