ARSA cDNA ORF Clone, Human, C-His tag

Cat: HG10449-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ARSA Reagents

CRO Services

Product recommended


All ARSA Reagents

ARSA cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1524 bp
Description
Full length Clone DNA of Human arylsulfatase A with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARSA cDNA ORF Clone, Human, C-His tag Alternative Names

MLD cDNA ORF Clone, Human

ARSA Background Information

Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

Full Name
arylsulfatase A
References
  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • ARSA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ARSA cDNA ORF Clone in Cloning Vector, Mouse MG50018-M
    ARSA cDNA ORF Clone, Mouse, untagged MG50018-UT
    ARSA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50018-ACG
    ARSA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50018-ACGLN
    ARSA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50018-ACR
    ARSA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50018-CF
    ARSA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50018-NF
    ARSA cDNA ORF Clone, Mouse, C-His tag MG50018-CH
    ARSA cDNA ORF Clone, Mouse, N-His tag MG50018-NH
    ARSA cDNA ORF Clone, Mouse, C-HA tag MG50018-CY
    ARSA cDNA ORF Clone, Mouse, N-HA tag MG50018-NY
    ARSA cDNA ORF Clone, Mouse, C-Myc tag MG50018-CM
    ARSA cDNA ORF Clone, Mouse, N-Myc tag MG50018-NM
    ARSA qPCR Primer Pairs, Mouse MP200018

    ARSA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ARSA cDNA ORF Clone in Cloning Vector, Human HG10449-M
    ARSA cDNA ORF Clone, Human, untagged HG10449-UT
    ARSA cDNA ORF Clone, Human, C-GFPSpark® tag HG10449-ACG
    ARSA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10449-ACGLN
    ARSA cDNA ORF Clone, Human, C-OFPSpark® tag HG10449-ACR
    ARSA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10449-CF
    ARSA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10449-NF
    ARSA cDNA ORF Clone, Human, N-His tag HG10449-NH
    ARSA cDNA ORF Clone, Human, C-HA tag HG10449-CY
    ARSA cDNA ORF Clone, Human, N-HA tag HG10449-NY
    ARSA cDNA ORF Clone, Human, C-Myc tag HG10449-CM
    ARSA cDNA ORF Clone, Human, N-Myc tag HG10449-NM
    ARSA qPCR Primer Pairs, Human HP100478
    info info
    添加购物车成功! 添加购物车失败!