ARL6IP6 cDNA ORF Clone, Human, C-HA tag

Cat: HG14613-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ARL6IP6 Reagents
CRO Services
Product recommended

All ARL6IP6 Reagents
ARL6IP6 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human ADP-ribosylation-like factor 6 interacting protein 6 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARL6IP6 cDNA ORF Clone, Human, C-HA tag Alternative Names
AIP-6 cDNA ORF Clone, Human;PFAAP1 cDNA ORF Clone, Human
ARL6IP6 Background Information
Full Name
ADP-ribosylation factor-like 6 interacting protein 6

ARL6IP6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARL6IP6 cDNA ORF Clone in Cloning Vector, Mouse MG52687-G
ARL6IP6 cDNA ORF Clone, Mouse, untagged MG52687-UT
ARL6IP6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52687-ACGLN
ARL6IP6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52687-ACG
ARL6IP6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52687-ACR
ARL6IP6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52687-CF
ARL6IP6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52687-NF
ARL6IP6 cDNA ORF Clone, Mouse, C-His tag MG52687-CH
ARL6IP6 cDNA ORF Clone, Mouse, N-His tag MG52687-NH
ARL6IP6 cDNA ORF Clone, Mouse, C-HA tag MG52687-CY
ARL6IP6 cDNA ORF Clone, Mouse, N-HA tag MG52687-NY
ARL6IP6 cDNA ORF Clone, Mouse, C-Myc tag MG52687-CM
ARL6IP6 cDNA ORF Clone, Mouse, N-Myc tag MG52687-NM
ARL6IP6 qPCR Primer Pairs, Mouse MP202558

ARL6IP6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARL6IP6 cDNA ORF Clone in Cloning Vector, Human HG14613-G
ARL6IP6 cDNA ORF Clone, Human, untagged HG14613-UT
ARL6IP6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14613-ACGLN
ARL6IP6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14613-ACG
ARL6IP6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14613-ACR
ARL6IP6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14613-CF
ARL6IP6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14613-NF
ARL6IP6 cDNA ORF Clone, Human, C-His tag HG14613-CH
ARL6IP6 cDNA ORF Clone, Human, N-His tag HG14613-NH
ARL6IP6 cDNA ORF Clone, Human, N-HA tag HG14613-NY
ARL6IP6 cDNA ORF Clone, Human, C-Myc tag HG14613-CM
ARL6IP6 cDNA ORF Clone, Human, N-Myc tag HG14613-NM
ARL6IP6 qPCR Primer Pairs, Human HP103247
info info
添加购物车成功! 添加购物车失败!