Androgen receptor cDNA ORF Clone, Human, N-Myc tag

Cat: HG13116-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Androgen receptor Reagents
CRO Services
Product recommended

All Androgen receptor Reagents
Androgen receptor cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1167 bp
Description
Full length Clone DNA of Human androgen receptor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Androgen receptor cDNA ORF Clone, Human, N-Myc tag Alternative Names
AIS cDNA ORF Clone, Human;DHTR cDNA ORF Clone, Human;HUMARA cDNA ORF Clone, Human;HYSP1 cDNA ORF Clone, Human;KD cDNA ORF Clone, Human;NR3C4 cDNA ORF Clone, Human;SBMA cDNA ORF Clone, Human;SMAX1 cDNA ORF Clone, Human;TFM cDNA ORF Clone, Human
Androgen receptor Background Information

The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (Kennedy disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Two alternatively spliced variants encoding distinct isoforms have been described.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
androgen receptor
References
  • Fajardo AM, MacKenzie DA, Olguin SL, Scariano JK, Rabinowitz I, Thompson TA. Antioxidants Abrogate Alpha-Tocopherylquinone-Mediated Down-Regulation of the Androgen Receptor in Androgen-Responsive Prostate Cancer Cells. Languino LR, ed. PLoS ONE. 2016;11(3):e0151525.
  • info info
    添加购物车成功! 添加购物车失败!