APE1 cDNA ORF Clone, Human, untagged

Cat: HG16161-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All APE1 Reagents
CRO Services
Product recommended

All APE1 Reagents
APE1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Human APEX nuclease (multifunctional DNA repair enzyme) 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APE1 cDNA ORF Clone, Human, untagged Alternative Names
APE cDNA ORF Clone, Human;APE1 cDNA ORF Clone, Human;APEN cDNA ORF Clone, Human;APEX cDNA ORF Clone, Human;APX cDNA ORF Clone, Human;HAP1 cDNA ORF Clone, Human;REF1 cDNA ORF Clone, Human
APE1 Background Information

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

Full Name
APEX nuclease (multifunctional DNA repair enzyme) 1
References
  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • APE1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    APE1 cDNA ORF Clone in Cloning Vector, Rhesus CG90434-G
    APE1 cDNA ORF Clone, Rhesus, untagged CG90434-UT
    APE1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90434-ACG
    APE1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90434-ACGLN
    APE1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90434-ANG
    APE1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90434-ACR
    APE1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90434-ANR
    APE1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90434-CF
    APE1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90434-NF
    APE1 cDNA ORF Clone, Rhesus, C-His tag CG90434-CH
    APE1 cDNA ORF Clone, Rhesus, N-His tag CG90434-NH
    APE1 cDNA ORF Clone, Rhesus, C-HA tag CG90434-CY
    APE1 cDNA ORF Clone, Rhesus, N-HA tag CG90434-NY
    APE1 cDNA ORF Clone, Rhesus, C-Myc tag CG90434-CM
    APE1 cDNA ORF Clone, Rhesus, N-Myc tag CG90434-NM

    APE1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    APE1 cDNA ORF Clone in Cloning Vector, Rat RG80756-U
    APE1 cDNA ORF Clone, Rat, untagged RG80756-UT
    APE1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80756-ACGLN
    APE1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80756-ACG
    APE1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80756-ANG
    APE1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80756-ACR
    APE1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80756-ANR
    APE1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80756-CF
    APE1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80756-NF
    APE1 cDNA ORF Clone, Rat, C-His tag RG80756-CH
    APE1 cDNA ORF Clone, Rat, N-His tag RG80756-NH
    APE1 cDNA ORF Clone, Rat, C-HA tag RG80756-CY
    APE1 cDNA ORF Clone, Rat, N-HA tag RG80756-NY
    APE1 cDNA ORF Clone, Rat, C-Myc tag RG80756-CM
    APE1 cDNA ORF Clone, Rat, N-Myc tag RG80756-NM
    APE1 qPCR Primer Pairs, Rat RP300720

    APE1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    APE1 cDNA ORF Clone in Cloning Vector, Mouse MG51694-U
    APE1 cDNA ORF Clone, Mouse, untagged MG51694-UT
    APE1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51694-ACGLN
    APE1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51694-ACG
    APE1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51694-ANG
    APE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51694-ACR
    APE1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51694-ANR
    APE1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51694-CF
    APE1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51694-NF
    APE1 cDNA ORF Clone, Mouse, C-His tag MG51694-CH
    APE1 cDNA ORF Clone, Mouse, N-His tag MG51694-NH
    APE1 cDNA ORF Clone, Mouse, C-HA tag MG51694-CY
    APE1 cDNA ORF Clone, Mouse, N-HA tag MG51694-NY
    APE1 cDNA ORF Clone, Mouse, C-Myc tag MG51694-CM
    APE1 cDNA ORF Clone, Mouse, N-Myc tag MG51694-NM
    APE1 qPCR Primer Pairs, Mouse MP201567

    APE1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    APE1 cDNA ORF Clone in Cloning Vector, Human HG16161-G
    APE1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16161-ACGLN
    APE1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16161-ACG
    APE1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16161-ANG
    APE1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16161-ACR
    APE1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16161-ANR
    APE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16161-CF
    APE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16161-NF
    APE1 cDNA ORF Clone, Human, C-His tag HG16161-CH
    APE1 cDNA ORF Clone, Human, N-His tag HG16161-NH
    APE1 cDNA ORF Clone, Human, C-HA tag HG16161-CY
    APE1 cDNA ORF Clone, Human, N-HA tag HG16161-NY
    APE1 cDNA ORF Clone, Human, C-Myc tag HG16161-CM
    APE1 cDNA ORF Clone, Human, N-Myc tag HG16161-NM
    APE1 qPCR Primer Pairs, Human HP104930
    info info
    添加购物车成功! 添加购物车失败!