ANKRD10 cDNA ORF Clone, Human, N-His tag

Cat: HG14266-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ANKRD10 Reagents
CRO Services
Product recommended

All ANKRD10 Reagents
ANKRD10 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
663 bp
Description
Full length Clone DNA of Human ankyrin repeat domain 10 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANKRD10 Background Information
Full Name
ankyrin repeat domain 10

ANKRD10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ANKRD10 cDNA ORF Clone in Cloning Vector, Rat RG8A0932-U
ANKRD10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0932-ACGLN

ANKRD10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANKRD10 cDNA ORF Clone in Cloning Vector, Mouse MG53296-U
ANKRD10 cDNA ORF Clone, Mouse, untagged MG53296-UT
ANKRD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53296-ACG
ANKRD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53296-ACGLN
ANKRD10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53296-ANG
ANKRD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53296-ACR
ANKRD10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53296-ANR
ANKRD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53296-CF
ANKRD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53296-NF
ANKRD10 cDNA ORF Clone, Mouse, C-His tag MG53296-CH
ANKRD10 cDNA ORF Clone, Mouse, N-His tag MG53296-NH
ANKRD10 cDNA ORF Clone, Mouse, C-HA tag MG53296-CY
ANKRD10 cDNA ORF Clone, Mouse, N-HA tag MG53296-NY
ANKRD10 cDNA ORF Clone, Mouse, C-Myc tag MG53296-CM
ANKRD10 cDNA ORF Clone, Mouse, N-Myc tag MG53296-NM

ANKRD10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANKRD10 cDNA ORF Clone in Cloning Vector, Human HG14266-G
ANKRD10 cDNA ORF Clone, Human, untagged HG14266-UT
ANKRD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14266-ACGLN
ANKRD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG14266-ACG
ANKRD10 cDNA ORF Clone, Human, N-GFPSpark® tag HG14266-ANG
ANKRD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG14266-ACR
ANKRD10 cDNA ORF Clone, Human, N-OFPSpark® tag HG14266-ANR
ANKRD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14266-CF
ANKRD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14266-NF
ANKRD10 cDNA ORF Clone, Human, C-His tag HG14266-CH
ANKRD10 cDNA ORF Clone, Human, C-HA tag HG14266-CY
ANKRD10 cDNA ORF Clone, Human, N-HA tag HG14266-NY
ANKRD10 cDNA ORF Clone, Human, C-Myc tag HG14266-CM
ANKRD10 cDNA ORF Clone, Human, N-Myc tag HG14266-NM
ANKRD10 qPCR Primer Pairs, Human HP102916
info info
添加购物车成功! 添加购物车失败!