ANK/ANKH cDNA ORF Clone, Human, C-HA tag

Cat: HG10496-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ANK/ANKH Reagents
CRO Services
Product recommended

All ANK/ANKH Reagents
ANK/ANKH cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1479 bp
Description
Full length Clone DNA of Human ankylosis, progressive homolog (mouse) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANK/ANKH cDNA ORF Clone, Human, C-HA tag Alternative Names
ANK cDNA ORF Clone, Human;CCAL2 cDNA ORF Clone, Human;CMDJ cDNA ORF Clone, Human;CPPDD cDNA ORF Clone, Human;HANK cDNA ORF Clone, Human;MANK cDNA ORF Clone, Human
ANK/ANKH Background Information
Full Name
ANKH inorganic pyrophosphate transport regulator

ANK/ANKH cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ANK/ANKH cDNA ORF Clone in Cloning Vector, Cynomolgus CG90519-G
ANK/ANKH cDNA ORF Clone, Cynomolgus, untagged CG90519-UT
ANK/ANKH Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90519-ACGLN
ANK/ANKH cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90519-ACG
ANK/ANKH cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90519-ACR
ANK/ANKH cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90519-CF
ANK/ANKH cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90519-NF
ANK/ANKH cDNA ORF Clone, Cynomolgus, C-His tag CG90519-CH
ANK/ANKH cDNA ORF Clone, Cynomolgus, N-His tag CG90519-NH
ANK/ANKH cDNA ORF Clone, Cynomolgus, C-HA tag CG90519-CY
ANK/ANKH cDNA ORF Clone, Cynomolgus, N-HA tag CG90519-NY
ANK/ANKH cDNA ORF Clone, Cynomolgus, C-Myc tag CG90519-CM
ANK/ANKH cDNA ORF Clone, Cynomolgus, N-Myc tag CG90519-NM

ANK/ANKH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANK/ANKH cDNA ORF Clone in Cloning Vector, Mouse MG50775-G
ANK/ANKH cDNA ORF Clone, Mouse, untagged MG50775-UT
ANK/ANKH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50775-ACGLN
ANK/ANKH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50775-ACG
ANK/ANKH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50775-ACR
ANK/ANKH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50775-CF
ANK/ANKH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50775-NF
ANK/ANKH cDNA ORF Clone, Mouse, C-His tag MG50775-CH
ANK/ANKH cDNA ORF Clone, Mouse, N-His tag MG50775-NH
ANK/ANKH cDNA ORF Clone, Mouse, C-HA tag MG50775-CY
ANK/ANKH cDNA ORF Clone, Mouse, N-HA tag MG50775-NY
ANK/ANKH cDNA ORF Clone, Mouse, C-Myc tag MG50775-CM
ANK/ANKH cDNA ORF Clone, Mouse, N-Myc tag MG50775-NM
ANK/ANKH qPCR Primer Pairs, Mouse MP200749

ANK/ANKH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANK/ANKH cDNA ORF Clone in Cloning Vector, Human HG10496-M
ANK/ANKH cDNA ORF Clone, Human, untagged HG10496-UT
ANK/ANKH cDNA ORF Clone, Human, C-GFPSpark® tag HG10496-ACG
ANK/ANKH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10496-ACGLN
ANK/ANKH cDNA ORF Clone, Human, C-OFPSpark® tag HG10496-ACR
ANK/ANKH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10496-CF
ANK/ANKH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10496-NF
ANK/ANKH cDNA ORF Clone, Human, C-His tag HG10496-CH
ANK/ANKH cDNA ORF Clone, Human, N-His tag HG10496-NH
ANK/ANKH cDNA ORF Clone, Human, N-HA tag HG10496-NY
ANK/ANKH cDNA ORF Clone, Human, C-Myc tag HG10496-CM
ANK/ANKH cDNA ORF Clone, Human, N-Myc tag HG10496-NM
ANK/ANKH qPCR Primer Pairs, Human HP100517
info info
添加购物车成功! 添加购物车失败!