AMIGO2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13735-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All AMIGO2 Reagents

CRO Services

Product recommended


All AMIGO2 Reagents

AMIGO2 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1569 bp
Description
Full length Clone DNA of Human adhesion molecule with Ig-like domain 2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AMIGO2 cDNA ORF Clone, Human, N-Myc tag Alternative Names

ALI1 cDNA ORF Clone, Human;AMIGO-2 cDNA ORF Clone, Human;DEGA cDNA ORF Clone, Human

AMIGO2 Background Information

AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

Full Name
adhesion molecule with Ig-like domain 2
References
  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • AMIGO2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    AMIGO2 cDNA ORF Clone in Cloning Vector, Mouse MG5A3184-G
    AMIGO2 cDNA ORF Clone, Mouse, untagged MG5A3184-UT
    AMIGO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3184-ACG
    AMIGO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3184-ACGLN
    AMIGO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3184-ACR
    AMIGO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3184-CF
    AMIGO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3184-NF
    AMIGO2 cDNA ORF Clone, Mouse, C-His tag MG5A3184-CH
    AMIGO2 cDNA ORF Clone, Mouse, N-His tag MG5A3184-NH
    AMIGO2 cDNA ORF Clone, Mouse, C-HA tag MG5A3184-CY
    AMIGO2 cDNA ORF Clone, Mouse, N-HA tag MG5A3184-NY
    AMIGO2 cDNA ORF Clone, Mouse, C-Myc tag MG5A3184-CM
    AMIGO2 cDNA ORF Clone, Mouse, N-Myc tag MG5A3184-NM

    AMIGO2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    AMIGO2 cDNA ORF Clone in Cloning Vector, Human HG13735-G
    AMIGO2 cDNA ORF Clone, Human, untagged HG13735-UT
    AMIGO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13735-ACG
    AMIGO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13735-ACGLN
    AMIGO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13735-ACR
    AMIGO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13735-CF
    AMIGO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13735-NF
    AMIGO2 cDNA ORF Clone, Human, C-His tag HG13735-CH
    AMIGO2 cDNA ORF Clone, Human, N-His tag HG13735-NH
    AMIGO2 cDNA ORF Clone, Human, C-HA tag HG13735-CY
    AMIGO2 cDNA ORF Clone, Human, N-HA tag HG13735-NY
    AMIGO2 cDNA ORF Clone, Human, C-Myc tag HG13735-CM
    AMIGO2 qPCR Primer Pairs, Human HP102412
    info info
    添加购物车成功! 添加购物车失败!