AMHR2 cDNA ORF Clone, Human, N-HA tag

Cat: HG15785-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All AMHR2 Reagents

CRO Services

Product recommended


All AMHR2 Reagents

AMHR2 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1722 bp
Description
Full length Clone DNA of Human anti-Mullerian hormone receptor, type II with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AMHR2 cDNA ORF Clone, Human, N-HA tag Alternative Names

AMHR cDNA ORF Clone, Human;MISR2 cDNA ORF Clone, Human;MISRII cDNA ORF Clone, Human;MRII cDNA ORF Clone, Human

AMHR2 Background Information

Full Name
anti-Mullerian hormone receptor, type II

AMHR2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AMHR2 cDNA ORF Clone in Cloning Vector, Rat RG80067-M
AMHR2 cDNA ORF Clone, Rat, untagged RG80067-UT
AMHR2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80067-ACG
AMHR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80067-ACGLN
AMHR2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80067-ACR
AMHR2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80067-CF
AMHR2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80067-NF
AMHR2 cDNA ORF Clone, Rat, C-His tag RG80067-CH
AMHR2 cDNA ORF Clone, Rat, N-His tag RG80067-NH
AMHR2 cDNA ORF Clone, Rat, C-HA tag RG80067-CY
AMHR2 cDNA ORF Clone, Rat, N-HA tag RG80067-NY
AMHR2 cDNA ORF Clone, Rat, C-Myc tag RG80067-CM
AMHR2 cDNA ORF Clone, Rat, N-Myc tag RG80067-NM
AMHR2 qPCR Primer Pairs, Rat RP300065

AMHR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AMHR2 cDNA ORF Clone in Cloning Vector, Human HG15785-G
AMHR2 cDNA ORF Clone, Human, untagged HG15785-UT
AMHR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15785-ACGLN
AMHR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15785-ACG
AMHR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15785-ACR
AMHR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15785-CF
AMHR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15785-NF
AMHR2 cDNA ORF Clone, Human, C-His tag HG15785-CH
AMHR2 cDNA ORF Clone, Human, N-His tag HG15785-NH
AMHR2 cDNA ORF Clone, Human, C-HA tag HG15785-CY
AMHR2 cDNA ORF Clone, Human, C-Myc tag HG15785-CM
AMHR2 cDNA ORF Clone, Human, N-Myc tag HG15785-NM
AMHR2 qPCR Primer Pairs, Human HP104376
info info
添加购物车成功! 添加购物车失败!