ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-HA tag

Cat: HG15773-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALDH12/ALDH8A1 Reagents
CRO Services
Product recommended

All ALDH12/ALDH8A1 Reagents
ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1464 bp
Description
Full length Clone DNA of Human aldehyde dehydrogenase 8 family, member A1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-HA tag Alternative Names
ALDH12 cDNA ORF Clone, Human;DJ352A20.2 cDNA ORF Clone, Human
ALDH12/ALDH8A1 Background Information
Full Name
aldehyde dehydrogenase 8 family, member A1

ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALDH12/ALDH8A1 cDNA ORF Clone in Cloning Vector, Mouse MG5A1959-U
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, untagged MG5A1959-UT
ALDH12/ALDH8A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1959-ACGLN
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1959-ACG
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1959-ANG
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1959-ACR
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1959-ANR
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1959-CF
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1959-NF
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, C-His tag MG5A1959-CH
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, N-His tag MG5A1959-NH
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, C-HA tag MG5A1959-CY
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, N-HA tag MG5A1959-NY
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, C-Myc tag MG5A1959-CM
ALDH12/ALDH8A1 cDNA ORF Clone, Mouse, N-Myc tag MG5A1959-NM

ALDH12/ALDH8A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALDH12/ALDH8A1 cDNA ORF Clone in Cloning Vector, Human HG15773-G
ALDH12/ALDH8A1 cDNA ORF Clone, Human, untagged HG15773-UT
ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15773-ACG
ALDH12/ALDH8A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15773-ACGLN
ALDH12/ALDH8A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15773-ANG
ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15773-ACR
ALDH12/ALDH8A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15773-ANR
ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15773-CF
ALDH12/ALDH8A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15773-NF
ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-His tag HG15773-CH
ALDH12/ALDH8A1 cDNA ORF Clone, Human, N-His tag HG15773-NH
ALDH12/ALDH8A1 cDNA ORF Clone, Human, N-HA tag HG15773-NY
ALDH12/ALDH8A1 cDNA ORF Clone, Human, C-Myc tag HG15773-CM
ALDH12/ALDH8A1 cDNA ORF Clone, Human, N-Myc tag HG15773-NM
ALDH12/ALDH8A1 qPCR Primer Pairs, Human HP104364
info info
添加购物车成功! 添加购物车失败!