ALDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12064-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ALDH2 Reagents

CRO Services

Product recommended


All ALDH2 Reagents

ALDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1554 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human aldehyde dehydrogenase 2 family (mitochondrial) with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.59kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ALDH2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Human aFGF/FGF1 Gene Plasmid Map 5637

ALDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

ALDH-E2 cDNA ORF Clone, Human;ALDHI cDNA ORF Clone, Human;ALDM cDNA ORF Clone, Human

ALDH2 Background Information

Full Name
aldehyde dehydrogenase 2 family (mitochondrial)

ALDH2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ALDH2 cDNA ORF Clone in Cloning Vector, Rat RG81479-G

ALDH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALDH2 cDNA ORF Clone in Cloning Vector, Mouse MG52760-G
ALDH2 cDNA ORF Clone, Mouse, untagged MG52760-UT
ALDH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52760-ACGLN
ALDH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52760-ACG
ALDH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52760-ACR
ALDH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52760-CF
ALDH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52760-NF
ALDH2 cDNA ORF Clone, Mouse, C-His tag MG52760-CH
ALDH2 cDNA ORF Clone, Mouse, N-His tag MG52760-NH
ALDH2 cDNA ORF Clone, Mouse, C-HA tag MG52760-CY
ALDH2 cDNA ORF Clone, Mouse, N-HA tag MG52760-NY
ALDH2 cDNA ORF Clone, Mouse, C-Myc tag MG52760-CM
ALDH2 cDNA ORF Clone, Mouse, N-Myc tag MG52760-NM

ALDH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALDH2 cDNA ORF Clone in Cloning Vector, Human HG12064-G
ALDH2 cDNA ORF Clone, Human, untagged HG12064-UT
ALDH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12064-ACGLN
ALDH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12064-ACG
ALDH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12064-ANG
ALDH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12064-ACR
ALDH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12064-ANR
ALDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12064-CF
ALDH2 cDNA ORF Clone, Human, C-His tag HG12064-CH
ALDH2 cDNA ORF Clone, Human, N-His tag HG12064-NH
ALDH2 cDNA ORF Clone, Human, C-HA tag HG12064-CY
ALDH2 cDNA ORF Clone, Human, N-HA tag HG12064-NY
ALDH2 cDNA ORF Clone, Human, C-Myc tag HG12064-CM
ALDH2 cDNA ORF Clone, Human, N-Myc tag HG12064-NM
ALDH2 qPCR Primer Pairs, Human HP101595
info info
添加购物车成功! 添加购物车失败!