AKT2 cDNA ORF Clone, Human, N-His tag

Cat: HG10764-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AKT2 Reagents
CRO Services
Product recommended

All AKT2 Reagents
AKT2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1446 bp
Description
Full length Clone DNA of Human v-akt murine thymoma viral oncogene homolog 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKT2 cDNA ORF Clone, Human, N-His tag Alternative Names
HIHGHH cDNA ORF Clone, Human;PKBB cDNA ORF Clone, Human;PKBBETA cDNA ORF Clone, Human;PRKBB cDNA ORF Clone, Human;RAC-BETA cDNA ORF Clone, Human
AKT2 Background Information
Full Name
v-akt murine thymoma viral oncogene homolog 2

AKT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AKT2 cDNA ORF Clone in Cloning Vector, Rat RG81152-U
AKT2 cDNA ORF Clone, Rat, untagged RG81152-UT
AKT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81152-ACGLN
AKT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81152-ACG
AKT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81152-ANG
AKT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81152-ACR
AKT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81152-ANR
AKT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81152-CF
AKT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81152-NF
AKT2 cDNA ORF Clone, Rat, C-His tag RG81152-CH
AKT2 cDNA ORF Clone, Rat, N-His tag RG81152-NH
AKT2 cDNA ORF Clone, Rat, C-HA tag RG81152-CY
AKT2 cDNA ORF Clone, Rat, N-HA tag RG81152-NY
AKT2 cDNA ORF Clone, Rat, C-Myc tag RG81152-CM
AKT2 cDNA ORF Clone, Rat, N-Myc tag RG81152-NM
AKT2 qPCR Primer Pairs, Rat RP301108

AKT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AKT2 cDNA ORF Clone in Cloning Vector, Mouse MG51023-G
AKT2 cDNA ORF Clone, Mouse, untagged MG51023-UT
AKT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51023-ACG
AKT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51023-ACGLN
AKT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51023-ANG
AKT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51023-ACR
AKT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51023-ANR
AKT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51023-CF
AKT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51023-NF
AKT2 cDNA ORF Clone, Mouse, C-His tag MG51023-CH
AKT2 cDNA ORF Clone, Mouse, N-His tag MG51023-NH
AKT2 cDNA ORF Clone, Mouse, C-HA tag MG51023-CY
AKT2 cDNA ORF Clone, Mouse, N-HA tag MG51023-NY
AKT2 cDNA ORF Clone, Mouse, C-Myc tag MG51023-CM
AKT2 cDNA ORF Clone, Mouse, N-Myc tag MG51023-NM
AKT2 qPCR Primer Pairs, Mouse MP200982

AKT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AKT2 cDNA ORF Clone in Cloning Vector, Human HG10764-G
AKT2 cDNA ORF Clone, Human, untagged HG10764-UT
AKT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10764-ACG
AKT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10764-ACGLN
AKT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10764-ANG
AKT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10764-ACR
AKT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10764-ANR
AKT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10764-CF
AKT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10764-NF
AKT2 cDNA ORF Clone, Human, C-His tag HG10764-CH
AKT2 cDNA ORF Clone, Human, C-HA tag HG10764-CY
AKT2 cDNA ORF Clone, Human, N-HA tag HG10764-NY
AKT2 cDNA ORF Clone, Human, C-Myc tag HG10764-CM
AKT2 cDNA ORF Clone, Human, N-Myc tag HG10764-NM
AKT2 qPCR Primer Pairs, Human HP100903
info info
添加购物车成功! 添加购物车失败!