AKR1D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15643-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All AKR1D1 Reagents

CRO Services

Product recommended


All AKR1D1 Reagents

AKR1D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Human aldo-keto reductase family 1, member D1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKR1D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

3o5bred cDNA ORF Clone, Human;CBAS2 cDNA ORF Clone, Human;SRD5B1 cDNA ORF Clone, Human

AKR1D1 Background Information

Full Name
aldo-keto reductase family 1, member D1

AKR1D1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AKR1D1 cDNA ORF Clone in Cloning Vector, Mouse MG56405-U
AKR1D1 cDNA ORF Clone, Mouse, untagged MG56405-UT
AKR1D1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56405-ACGLN
AKR1D1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56405-ACG
AKR1D1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG56405-ANG
AKR1D1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG56405-ACR
AKR1D1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG56405-ANR
AKR1D1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG56405-CF
AKR1D1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG56405-NF
AKR1D1 cDNA ORF Clone, Mouse, C-His tag MG56405-CH
AKR1D1 cDNA ORF Clone, Mouse, N-His tag MG56405-NH
AKR1D1 cDNA ORF Clone, Mouse, C-HA tag MG56405-CY
AKR1D1 cDNA ORF Clone, Mouse, N-HA tag MG56405-NY
AKR1D1 cDNA ORF Clone, Mouse, C-Myc tag MG56405-CM
AKR1D1 cDNA ORF Clone, Mouse, N-Myc tag MG56405-NM

AKR1D1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AKR1D1 cDNA ORF Clone in Cloning Vector, Human HG15643-G
AKR1D1 cDNA ORF Clone, Human, untagged HG15643-UT
AKR1D1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15643-ACGLN
AKR1D1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15643-ACG
AKR1D1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15643-ANG
AKR1D1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15643-ACR
AKR1D1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15643-ANR
AKR1D1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15643-NF
AKR1D1 cDNA ORF Clone, Human, C-His tag HG15643-CH
AKR1D1 cDNA ORF Clone, Human, N-His tag HG15643-NH
AKR1D1 cDNA ORF Clone, Human, C-HA tag HG15643-CY
AKR1D1 cDNA ORF Clone, Human, N-HA tag HG15643-NY
AKR1D1 cDNA ORF Clone, Human, C-Myc tag HG15643-CM
AKR1D1 cDNA ORF Clone, Human, N-Myc tag HG15643-NM
AKR1D1 qPCR Primer Pairs, Human HP104261
info info
添加购物车成功! 添加购物车失败!