Adiponectin Receptor 2 cDNA ORF Clone, Human, C-HA tag

Cat: HG15173-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Adiponectin Receptor 2 Reagents
CRO Services
Product recommended

All Adiponectin Receptor 2 Reagents
Adiponectin Receptor 2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1161 bp
Description
Full length Clone DNA of Human adiponectin receptor 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Adiponectin Receptor 2 cDNA ORF Clone, Human, C-HA tag Alternative Names
ACDCR2 cDNA ORF Clone, Human;PAQR2 cDNA ORF Clone, Human
Adiponectin Receptor 2 Background Information
Full Name
adiponectin receptor 2

Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90322-G
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, untagged CG90322-UT
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90322-ACG
Adiponectin Receptor 2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90322-ACGLN
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90322-ACR
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90322-CF
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90322-NF
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, C-His tag CG90322-CH
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, N-His tag CG90322-NH
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90322-CY
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90322-NY
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90322-CM
Adiponectin Receptor 2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90322-NM

Adiponectin Receptor 2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 2 cDNA ORF Clone in Cloning Vector, Canine DG70116-G

Adiponectin Receptor 2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 2 cDNA ORF Clone in Cloning Vector, Rat RG81074-G

Adiponectin Receptor 2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Adiponectin Receptor 2 cDNA ORF Clone in Cloning Vector, Human HG15173-G
Adiponectin Receptor 2 cDNA ORF Clone, Human, untagged HG15173-UT
Adiponectin Receptor 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15173-ACG
Adiponectin Receptor 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15173-ACGLN
Adiponectin Receptor 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15173-ACR
Adiponectin Receptor 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15173-CF
Adiponectin Receptor 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15173-NF
Adiponectin Receptor 2 cDNA ORF Clone, Human, C-His tag HG15173-CH
Adiponectin Receptor 2 cDNA ORF Clone, Human, N-His tag HG15173-NH
Adiponectin Receptor 2 cDNA ORF Clone, Human, N-HA tag HG15173-NY
Adiponectin Receptor 2 cDNA ORF Clone, Human, C-Myc tag HG15173-CM
Adiponectin Receptor 2 cDNA ORF Clone, Human, N-Myc tag HG15173-NM
Adiponectin Receptor 2 qPCR Primer Pairs, Human HP103800
info info
添加购物车成功! 添加购物车失败!