Arp6 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14893-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Arp6 Reagents
CRO Services
Product recommended

All Arp6 Reagents
Arp6 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Human ARP6 actin-related protein 6 homolog (yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Arp6 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ARP6 cDNA ORF Clone, Human;CDA12 cDNA ORF Clone, Human;hARP6 cDNA ORF Clone, Human;hARPX cDNA ORF Clone, Human;HSPC281 cDNA ORF Clone, Human;MSTP136 cDNA ORF Clone, Human
Arp6 Background Information
Full Name
ARP6 actin-related protein 6 homolog (yeast)

Arp6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Arp6 cDNA ORF Clone in Cloning Vector, Mouse MG53328-U
Arp6 cDNA ORF Clone, Mouse, untagged MG53328-UT
Arp6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53328-ACG
Arp6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53328-ACGLN
Arp6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53328-ANG
Arp6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53328-ACR
Arp6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53328-ANR
Arp6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53328-CF
Arp6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53328-NF
Arp6 cDNA ORF Clone, Mouse, C-His tag MG53328-CH
Arp6 cDNA ORF Clone, Mouse, N-His tag MG53328-NH
Arp6 cDNA ORF Clone, Mouse, C-HA tag MG53328-CY
Arp6 cDNA ORF Clone, Mouse, N-HA tag MG53328-NY
Arp6 cDNA ORF Clone, Mouse, C-Myc tag MG53328-CM
Arp6 cDNA ORF Clone, Mouse, N-Myc tag MG53328-NM

Arp6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Arp6 cDNA ORF Clone in Cloning Vector, Human HG14893-G
Arp6 cDNA ORF Clone, Human, untagged HG14893-UT
Arp6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14893-ACG
Arp6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14893-ACGLN
Arp6 cDNA ORF Clone, Human, N-GFPSpark® tag HG14893-ANG
Arp6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14893-ACR
Arp6 cDNA ORF Clone, Human, N-OFPSpark® tag HG14893-ANR
Arp6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14893-CF
Arp6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14893-NF
Arp6 cDNA ORF Clone, Human, C-His tag HG14893-CH
Arp6 cDNA ORF Clone, Human, N-His tag HG14893-NH
Arp6 cDNA ORF Clone, Human, C-HA tag HG14893-CY
Arp6 cDNA ORF Clone, Human, N-HA tag HG14893-NY
Arp6 cDNA ORF Clone, Human, C-Myc tag HG14893-CM
Arp6 qPCR Primer Pairs, Human HP103522
info info
添加购物车成功! 添加购物车失败!