Arp3 cDNA ORF Clone, Human, C-HA tag

Cat: HG15179-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Arp3 Reagents
CRO Services
Product recommended

All Arp3 Reagents
Arp3 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1257 bp
Description
Full length Clone DNA of Human ARP3 actin-related protein 3 homolog (yeast) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Arp3 cDNA ORF Clone, Human, C-HA tag Alternative Names
ARP3 cDNA ORF Clone, Human
Arp3 Background Information
Full Name
ARP3 actin-related protein 3 homolog (yeast)

Arp3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Arp3 cDNA ORF Clone in Cloning Vector, Mouse MG5A7623-U
Arp3 cDNA ORF Clone in Cloning Vector, Mouse MG53221-G
Arp3 cDNA ORF Clone, Mouse, untagged MG53221-UT
Arp3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53221-ACG
Arp3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7623-ACGLN
Arp3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53221-ACGLN
Arp3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53221-ANG
Arp3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53221-ACR
Arp3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53221-ANR
Arp3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53221-CF
Arp3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53221-NF
Arp3 cDNA ORF Clone, Mouse, C-His tag MG53221-CH
Arp3 cDNA ORF Clone, Mouse, N-His tag MG53221-NH
Arp3 cDNA ORF Clone, Mouse, C-HA tag MG53221-CY
Arp3 cDNA ORF Clone, Mouse, N-HA tag MG53221-NY
Arp3 cDNA ORF Clone, Mouse, C-Myc tag MG53221-CM
Arp3 cDNA ORF Clone, Mouse, N-Myc tag MG53221-NM

Arp3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Arp3 cDNA ORF Clone in Cloning Vector, Human HG15179-G
Arp3 cDNA ORF Clone, Human, untagged HG15179-UT
Arp3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15179-ACG
Arp3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15179-ACGLN
Arp3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15179-ANG
Arp3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15179-ACR
Arp3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15179-ANR
Arp3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15179-CF
Arp3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15179-NF
Arp3 cDNA ORF Clone, Human, C-His tag HG15179-CH
Arp3 cDNA ORF Clone, Human, N-His tag HG15179-NH
Arp3 cDNA ORF Clone, Human, N-HA tag HG15179-NY
Arp3 cDNA ORF Clone, Human, C-Myc tag HG15179-CM
Arp3 cDNA ORF Clone, Human, N-Myc tag HG15179-NM
Arp3 qPCR Primer Pairs, Human HP103806
info info
添加购物车成功! 添加购物车失败!