alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10971-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All alpha Actinin 4/ACTN4 Reagents
CRO Services
Product recommended

All alpha Actinin 4/ACTN4 Reagents
alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2775 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human actinin, alpha 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+2.78kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
alpha Actinin 4/ACTN4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
alpha Actinin 4/ACTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ACTININ-4 cDNA ORF Clone, Human;FSGS cDNA ORF Clone, Human;FSGS1 cDNA ORF Clone, Human
alpha Actinin 4/ACTN4 Background Information

Actinin, alpha 4 (ACTN4), a nonmuscle cytoskeleton protein, has been frequently reported to be associated with cell motility and cancer metastasis. Honda et al. have suggested that cytoplasmic ACTN4 increases cell motility and is associated with a high metastatic potential and a poor prognosis of cancer based on their studies on multiple cancer cell lines. Since then, ACTN4 has been reported to be associated with the progression and metastasis of many types of cancer, including breast, colorectal, pancreatic, lung, brain, bladder, and ovarian cancers and salivary gland carcinoma.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
actinin, alpha 4
References
  • Gao Y, Li G, Sun L, et al. ACTN4 and the pathways associated with cell motility and adhesion contribute to the process of lung cancer metastasis to the brain. BMC Cancer. 2015;15:277.
  • Fukumoto M, Kurisu S, Yamada T, Takenawa T. α-Actinin-4 Enhances Colorectal Cancer Cell Invasion by Suppressing Focal Adhesion Maturation. St-Pierre Y, ed. PLoS ONE. 2015;10(4):e0120616.
  • info info
    添加购物车成功! 添加购物车失败!