ACADSB cDNA ORF Clone, Human, N-HA tag

Cat: HG11163-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ACADSB Reagents

CRO Services

Product recommended


All ACADSB Reagents

ACADSB cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Description
Full length Clone DNA of Human acyl-Coenzyme A dehydrogenase, short/branched chain with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACADSB cDNA ORF Clone, Human, N-HA tag Alternative Names

2-MEBCAD cDNA ORF Clone, Human;ACAD7 cDNA ORF Clone, Human;SBCAD cDNA ORF Clone, Human

ACADSB Background Information

Full Name
acyl-CoA dehydrogenase, short/branched chain

ACADSB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACADSB cDNA ORF Clone in Cloning Vector, Mouse MG51626-U
ACADSB cDNA ORF Clone, Mouse, untagged MG51626-UT
ACADSB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51626-ACGLN
ACADSB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51626-ACG
ACADSB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51626-ANG
ACADSB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51626-ACR
ACADSB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51626-ANR
ACADSB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51626-CF
ACADSB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51626-NF
ACADSB cDNA ORF Clone, Mouse, C-His tag MG51626-CH
ACADSB cDNA ORF Clone, Mouse, N-His tag MG51626-NH
ACADSB cDNA ORF Clone, Mouse, C-HA tag MG51626-CY
ACADSB cDNA ORF Clone, Mouse, N-HA tag MG51626-NY
ACADSB cDNA ORF Clone, Mouse, C-Myc tag MG51626-CM
ACADSB cDNA ORF Clone, Mouse, N-Myc tag MG51626-NM
ACADSB qPCR Primer Pairs, Mouse MP201499

ACADSB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACADSB cDNA ORF Clone in Cloning Vector, Human HG11163-M
ACADSB cDNA ORF Clone, Human, untagged HG11163-UT
ACADSB cDNA ORF Clone, Human, C-GFPSpark® tag HG11163-ACG
ACADSB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11163-ACGLN
ACADSB cDNA ORF Clone, Human, N-GFPSpark® tag HG11163-ANG
ACADSB cDNA ORF Clone, Human, C-OFPSpark® tag HG11163-ACR
ACADSB cDNA ORF Clone, Human, N-OFPSpark® tag HG11163-ANR
ACADSB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11163-CF
ACADSB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11163-NF
ACADSB cDNA ORF Clone, Human, C-His tag HG11163-CH
ACADSB cDNA ORF Clone, Human, N-His tag HG11163-NH
ACADSB cDNA ORF Clone, Human, C-HA tag HG11163-CY
ACADSB cDNA ORF Clone, Human, C-Myc tag HG11163-CM
ACADSB cDNA ORF Clone, Human, N-Myc tag HG11163-NM
ACADSB qPCR Primer Pairs, Human HP101070
info info
添加购物车成功! 添加购物车失败!