ABCF2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14308-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ABCF2 Reagents

CRO Services

Product recommended


All ABCF2 Reagents

ABCF2 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1872 bp
Description
Full length Clone DNA of Human ATP-binding cassette, sub-family F (GCN20), member 2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ABCF2 cDNA ORF Clone, Human, N-Myc tag Alternative Names

ABC28 cDNA ORF Clone, Human;EST133090 cDNA ORF Clone, Human;HUSSY-18 cDNA ORF Clone, Human;HUSSY18 cDNA ORF Clone, Human

ABCF2 Background Information

Full Name
ATP-binding cassette, sub-family F (GCN20), member 2

ABCF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ABCF2 cDNA ORF Clone in Cloning Vector, Mouse MG52676-U
ABCF2 cDNA ORF Clone, Mouse, untagged MG52676-UT
ABCF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52676-ACGLN
ABCF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52676-ACG
ABCF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52676-ANG
ABCF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52676-ACR
ABCF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52676-ANR
ABCF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52676-CF
ABCF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52676-NF
ABCF2 cDNA ORF Clone, Mouse, C-His tag MG52676-CH
ABCF2 cDNA ORF Clone, Mouse, N-His tag MG52676-NH
ABCF2 cDNA ORF Clone, Mouse, C-HA tag MG52676-CY
ABCF2 cDNA ORF Clone, Mouse, N-HA tag MG52676-NY
ABCF2 cDNA ORF Clone, Mouse, C-Myc tag MG52676-CM
ABCF2 cDNA ORF Clone, Mouse, N-Myc tag MG52676-NM
ABCF2 qPCR Primer Pairs, Mouse MP202547

ABCF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ABCF2 cDNA ORF Clone in Cloning Vector, Human HG14308-G
ABCF2 cDNA ORF Clone, Human, untagged HG14308-UT
ABCF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14308-ACGLN
ABCF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14308-ACG
ABCF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14308-ANG
ABCF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14308-ACR
ABCF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14308-ANR
ABCF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14308-CF
ABCF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14308-NF
ABCF2 cDNA ORF Clone, Human, C-His tag HG14308-CH
ABCF2 cDNA ORF Clone, Human, N-His tag HG14308-NH
ABCF2 cDNA ORF Clone, Human, C-HA tag HG14308-CY
ABCF2 cDNA ORF Clone, Human, N-HA tag HG14308-NY
ABCF2 cDNA ORF Clone, Human, C-Myc tag HG14308-CM
ABCF2 qPCR Primer Pairs, Human HP102958
info info
添加购物车成功! 添加购物车失败!