RPL10 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60057-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL10 Reagents
CRO Services
Product recommended

All RPL10 Reagents
RPL10 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
645 bp
Description
Full length Clone DNA of Ferret ribosomal protein L10 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL10 Background Information
Full Name
ribosomal protein L10

RPL10 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RPL10 cDNA ORF Clone in Cloning Vector, Ferret FG60057-G
RPL10 cDNA ORF Clone, Ferret, untagged FG60057-UT
RPL10 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60057-ACG
RPL10 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60057-ACGLN
RPL10 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60057-ANG
RPL10 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60057-ACR
RPL10 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60057-ANR
RPL10 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60057-CF
RPL10 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60057-NF
RPL10 cDNA ORF Clone, Ferret, C-His tag FG60057-CH
RPL10 cDNA ORF Clone, Ferret, N-His tag FG60057-NH
RPL10 cDNA ORF Clone, Ferret, C-HA tag FG60057-CY
RPL10 cDNA ORF Clone, Ferret, C-Myc tag FG60057-CM
RPL10 cDNA ORF Clone, Ferret, N-Myc tag FG60057-NM

RPL10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPL10 cDNA ORF Clone in Cloning Vector, Rat RG80723-U
RPL10 cDNA ORF Clone, Rat, untagged RG80723-UT
RPL10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80723-ACG
RPL10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80723-ACGLN
RPL10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80723-ANG
RPL10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80723-ACR
RPL10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80723-ANR
RPL10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80723-CF
RPL10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80723-NF
RPL10 cDNA ORF Clone, Rat, C-His tag RG80723-CH
RPL10 cDNA ORF Clone, Rat, N-His tag RG80723-NH
RPL10 cDNA ORF Clone, Rat, C-HA tag RG80723-CY
RPL10 cDNA ORF Clone, Rat, N-HA tag RG80723-NY
RPL10 cDNA ORF Clone, Rat, C-Myc tag RG80723-CM
RPL10 cDNA ORF Clone, Rat, N-Myc tag RG80723-NM
RPL10 qPCR Primer Pairs, Rat RP300687

RPL10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL10 cDNA ORF Clone in Cloning Vector, Mouse MG52135-G
RPL10 cDNA ORF Clone, Mouse, untagged MG52135-UT
RPL10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52135-ACG
RPL10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52135-ACGLN
RPL10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52135-ANG
RPL10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52135-ACR
RPL10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52135-ANR
RPL10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52135-CF
RPL10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52135-NF
RPL10 cDNA ORF Clone, Mouse, C-His tag MG52135-CH
RPL10 cDNA ORF Clone, Mouse, N-His tag MG52135-NH
RPL10 cDNA ORF Clone, Mouse, C-HA tag MG52135-CY
RPL10 cDNA ORF Clone, Mouse, N-HA tag MG52135-NY
RPL10 cDNA ORF Clone, Mouse, C-Myc tag MG52135-CM
RPL10 cDNA ORF Clone, Mouse, N-Myc tag MG52135-NM
RPL10 qPCR Primer Pairs, Mouse MP202008

RPL10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL10 cDNA ORF Clone in Cloning Vector, Human HG16153-G
RPL10 cDNA ORF Clone, Human, untagged HG16153-UT
RPL10 cDNA ORF Clone, Human, C-GFPSpark® tag HG16153-ACG
RPL10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16153-ACGLN
RPL10 cDNA ORF Clone, Human, N-GFPSpark® tag HG16153-ANG
RPL10 cDNA ORF Clone, Human, C-OFPSpark® tag HG16153-ACR
RPL10 cDNA ORF Clone, Human, N-OFPSpark® tag HG16153-ANR
RPL10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16153-CF
RPL10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16153-NF
RPL10 cDNA ORF Clone, Human, C-His tag HG16153-CH
RPL10 cDNA ORF Clone, Human, N-His tag HG16153-NH
RPL10 cDNA ORF Clone, Human, C-HA tag HG16153-CY
RPL10 cDNA ORF Clone, Human, N-HA tag HG16153-NY
RPL10 cDNA ORF Clone, Human, C-Myc tag HG16153-CM
RPL10 cDNA ORF Clone, Human, N-Myc tag HG16153-NM
RPL10 qPCR Primer Pairs, Human HP104922
info info
添加购物车成功! 添加购物车失败!