METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60040-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All METTL3/Methyltransferase like 3 Reagents

CRO Services

Product recommended


All METTL3/Methyltransferase like 3 Reagents

METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-HA tag General Information

Gene

Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1743 bp
Description
Full length Clone DNA of Ferret methyltransferase like 3 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METTL3/Methyltransferase like 3 Background Information

Full Name
methyltransferase like 3

METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
METTL3/Methyltransferase like 3 cDNA ORF Clone in Cloning Vector, Ferret FG60040-G
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, untagged FG60040-UT
METTL3/Methyltransferase like 3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60040-ACGLN
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60040-ACG
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60040-ANG
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60040-ACR
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60040-ANR
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60040-CF
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60040-NF
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-His tag FG60040-CH
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-His tag FG60040-NH
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-HA tag FG60040-CY
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-Myc tag FG60040-CM
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-Myc tag FG60040-NM

METTL3/Methyltransferase like 3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
METTL3/Methyltransferase like 3 cDNA ORF Clone in Cloning Vector, Rat RG8A0949-U
METTL3/Methyltransferase like 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0949-ACGLN

METTL3/Methyltransferase like 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
METTL3/Methyltransferase like 3 cDNA ORF Clone, Human, untagged HG23100-UT
info info
添加购物车成功! 添加购物车失败!