HNRNPF cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60063-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HNRNPF Reagents

CRO Services

Product recommended


All HNRNPF Reagents

HNRNPF cDNA ORF Clone, Ferret, C-Myc tag General Information

Gene

Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Ferret heterogeneous nuclear ribonucleoprotein F with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPF Background Information

Full Name
heterogeneous nuclear ribonucleoprotein F

HNRNPF cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
HNRNPF cDNA ORF Clone in Cloning Vector, Ferret FG60063-G
HNRNPF cDNA ORF Clone, Ferret, untagged FG60063-UT
HNRNPF cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60063-ACG
HNRNPF Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60063-ACGLN
HNRNPF cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60063-ANG
HNRNPF cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60063-ACR
HNRNPF cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60063-ANR
HNRNPF cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60063-CF
HNRNPF cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60063-NF
HNRNPF cDNA ORF Clone, Ferret, C-His tag FG60063-CH
HNRNPF cDNA ORF Clone, Ferret, N-His tag FG60063-NH
HNRNPF cDNA ORF Clone, Ferret, C-HA tag FG60063-CY
HNRNPF cDNA ORF Clone, Ferret, N-HA tag FG60063-NY
HNRNPF cDNA ORF Clone, Ferret, N-Myc tag FG60063-NM

HNRNPF cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HNRNPF cDNA ORF Clone in Cloning Vector, Rat RG81417-G

HNRNPF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPF cDNA ORF Clone in Cloning Vector, Human HG14268-G
HNRNPF cDNA ORF Clone, Human, untagged HG14268-UT
HNRNPF cDNA ORF Clone, Human, C-GFPSpark® tag HG14268-ACG
HNRNPF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14268-ACGLN
HNRNPF cDNA ORF Clone, Human, N-GFPSpark® tag HG14268-ANG
HNRNPF cDNA ORF Clone, Human, C-OFPSpark® tag HG14268-ACR
HNRNPF cDNA ORF Clone, Human, N-OFPSpark® tag HG14268-ANR
HNRNPF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14268-CF
HNRNPF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14268-NF
HNRNPF cDNA ORF Clone, Human, C-His tag HG14268-CH
HNRNPF cDNA ORF Clone, Human, N-His tag HG14268-NH
HNRNPF cDNA ORF Clone, Human, C-HA tag HG14268-CY
HNRNPF cDNA ORF Clone, Human, N-HA tag HG14268-NY
HNRNPF cDNA ORF Clone, Human, C-Myc tag HG14268-CM
HNRNPF cDNA ORF Clone, Human, N-Myc tag HG14268-NM
HNRNPF qPCR Primer Pairs, Human HP102918
info info
添加购物车成功! 添加购物车失败!