GSKIP cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60080-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GSKIP Reagents
CRO Services
Product recommended

All GSKIP Reagents
GSKIP cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
414 bp
Description
Full length Clone DNA of Ferret GSK3B interacting protein with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSKIP Background Information
Full Name
GSK3B interacting protein

GSKIP cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
GSKIP cDNA ORF Clone in Cloning Vector, Ferret FG60080-G
GSKIP cDNA ORF Clone, Ferret, untagged FG60080-UT
GSKIP cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60080-ACG
GSKIP Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60080-ACGLN
GSKIP cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60080-ANG
GSKIP cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60080-ACR
GSKIP cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60080-ANR
GSKIP cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60080-CF
GSKIP cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60080-NF
GSKIP cDNA ORF Clone, Ferret, C-His tag FG60080-CH
GSKIP cDNA ORF Clone, Ferret, N-His tag FG60080-NH
GSKIP cDNA ORF Clone, Ferret, C-HA tag FG60080-CY
GSKIP cDNA ORF Clone, Ferret, N-HA tag FG60080-NY
GSKIP cDNA ORF Clone, Ferret, N-Myc tag FG60080-NM

GSKIP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GSKIP cDNA ORF Clone in Cloning Vector, Rat RG81165-U
GSKIP cDNA ORF Clone, Rat, untagged RG81165-UT
GSKIP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81165-ACGLN
GSKIP cDNA ORF Clone, Rat, C-GFPSpark® tag RG81165-ACG
GSKIP cDNA ORF Clone, Rat, N-GFPSpark® tag RG81165-ANG
GSKIP cDNA ORF Clone, Rat, C-OFPSpark® tag RG81165-ACR
GSKIP cDNA ORF Clone, Rat, N-OFPSpark® tag RG81165-ANR
GSKIP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81165-CF
GSKIP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81165-NF
GSKIP cDNA ORF Clone, Rat, C-His tag RG81165-CH
GSKIP cDNA ORF Clone, Rat, N-His tag RG81165-NH
GSKIP cDNA ORF Clone, Rat, C-HA tag RG81165-CY
GSKIP cDNA ORF Clone, Rat, N-HA tag RG81165-NY
GSKIP cDNA ORF Clone, Rat, C-Myc tag RG81165-CM
GSKIP cDNA ORF Clone, Rat, N-Myc tag RG81165-NM
GSKIP qPCR Primer Pairs, Rat RP301121

GSKIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSKIP cDNA ORF Clone in Cloning Vector, Mouse MG51917-U
GSKIP cDNA ORF Clone, Mouse, untagged MG51917-UT
GSKIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51917-ACG
GSKIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51917-ACGLN
GSKIP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51917-ANG
GSKIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51917-ACR
GSKIP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51917-ANR
GSKIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51917-CF
GSKIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51917-NF
GSKIP cDNA ORF Clone, Mouse, C-His tag MG51917-CH
GSKIP cDNA ORF Clone, Mouse, N-His tag MG51917-NH
GSKIP cDNA ORF Clone, Mouse, C-HA tag MG51917-CY
GSKIP cDNA ORF Clone, Mouse, N-HA tag MG51917-NY
GSKIP cDNA ORF Clone, Mouse, C-Myc tag MG51917-CM
GSKIP cDNA ORF Clone, Mouse, N-Myc tag MG51917-NM
GSKIP qPCR Primer Pairs, Mouse MP201790

GSKIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GSKIP cDNA ORF Clone in Cloning Vector, Human HG22573-U
GSKIP cDNA ORF Clone, Human, untagged HG22573-UT
GSKIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22573-ACGLN
GSKIP cDNA ORF Clone, Human, C-GFPSpark® tag HG22573-ACG
GSKIP cDNA ORF Clone, Human, N-GFPSpark® tag HG22573-ANG
GSKIP cDNA ORF Clone, Human, C-OFPSpark® tag HG22573-ACR
GSKIP cDNA ORF Clone, Human, N-OFPSpark® tag HG22573-ANR
GSKIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22573-CF
GSKIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22573-NF
GSKIP cDNA ORF Clone, Human, C-His tag HG22573-CH
GSKIP cDNA ORF Clone, Human, N-His tag HG22573-NH
GSKIP cDNA ORF Clone, Human, C-HA tag HG22573-CY
GSKIP cDNA ORF Clone, Human, N-HA tag HG22573-NY
GSKIP cDNA ORF Clone, Human, C-Myc tag HG22573-CM
GSKIP cDNA ORF Clone, Human, N-Myc tag HG22573-NM
info info
添加购物车成功! 添加购物车失败!