ATP5B cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60074-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP5B Reagents
CRO Services
Product recommended

All ATP5B Reagents
ATP5B cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1587 bp
Description
Full length Clone DNA of Ferret ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5B Background Information
Full Name
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

ATP5B cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ATP5B cDNA ORF Clone in Cloning Vector, Ferret FG60074-G
ATP5B cDNA ORF Clone, Ferret, untagged FG60074-UT
ATP5B cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60074-ACG
ATP5B Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60074-ACGLN
ATP5B cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60074-ANG
ATP5B cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60074-ACR
ATP5B cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60074-ANR
ATP5B cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60074-CF
ATP5B cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60074-NF
ATP5B cDNA ORF Clone, Ferret, C-His tag FG60074-CH
ATP5B cDNA ORF Clone, Ferret, N-His tag FG60074-NH
ATP5B cDNA ORF Clone, Ferret, C-HA tag FG60074-CY
ATP5B cDNA ORF Clone, Ferret, N-HA tag FG60074-NY
ATP5B cDNA ORF Clone, Ferret, N-Myc tag FG60074-NM

ATP5B cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
ATP5B cDNA ORF Clone in Cloning Vector, Rabbit TG65033-G
ATP5B cDNA ORF Clone, Rabbit, untagged TG65033-UT
ATP5B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65033-ACG
ATP5B Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65033-ACGLN
ATP5B cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65033-ANG
ATP5B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65033-ACR
ATP5B cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65033-ANR
ATP5B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65033-CF
ATP5B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65033-NF
ATP5B cDNA ORF Clone, Rabbit, C-His tag TG65033-CH
ATP5B cDNA ORF Clone, Rabbit, N-His tag TG65033-NH
ATP5B cDNA ORF Clone, Rabbit, C-HA tag TG65033-CY
ATP5B cDNA ORF Clone, Rabbit, N-HA tag TG65033-NY
ATP5B cDNA ORF Clone, Rabbit, C-Myc tag TG65033-CM
ATP5B cDNA ORF Clone, Rabbit, N-Myc tag TG65033-NM

ATP5B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP5B cDNA ORF Clone in Cloning Vector, Rat RG81388-G

ATP5B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5B cDNA ORF Clone in Cloning Vector, Mouse MG51412-G
ATP5B cDNA ORF Clone, Mouse, untagged MG51412-UT
ATP5B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51412-ACGLN
ATP5B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51412-ACG
ATP5B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51412-ANG
ATP5B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51412-ACR
ATP5B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51412-ANR
ATP5B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51412-CF
ATP5B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51412-NF
ATP5B cDNA ORF Clone, Mouse, C-His tag MG51412-CH
ATP5B cDNA ORF Clone, Mouse, N-His tag MG51412-NH
ATP5B cDNA ORF Clone, Mouse, C-HA tag MG51412-CY
ATP5B cDNA ORF Clone, Mouse, N-HA tag MG51412-NY
ATP5B cDNA ORF Clone, Mouse, C-Myc tag MG51412-CM
ATP5B cDNA ORF Clone, Mouse, N-Myc tag MG51412-NM
ATP5B qPCR Primer Pairs, Mouse MP201296

ATP5B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5B cDNA ORF Clone in Cloning Vector, Human HG14844-G
ATP5B cDNA ORF Clone, Human, untagged HG14844-UT
ATP5B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14844-ACGLN
ATP5B cDNA ORF Clone, Human, C-GFPSpark® tag HG14844-ACG
ATP5B cDNA ORF Clone, Human, N-GFPSpark® tag HG14844-ANG
ATP5B cDNA ORF Clone, Human, C-OFPSpark® tag HG14844-ACR
ATP5B cDNA ORF Clone, Human, N-OFPSpark® tag HG14844-ANR
ATP5B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14844-CF
ATP5B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14844-NF
ATP5B cDNA ORF Clone, Human, C-His tag HG14844-CH
ATP5B cDNA ORF Clone, Human, N-His tag HG14844-NH
ATP5B cDNA ORF Clone, Human, C-HA tag HG14844-CY
ATP5B cDNA ORF Clone, Human, N-HA tag HG14844-NY
ATP5B cDNA ORF Clone, Human, C-Myc tag HG14844-CM
ATP5B cDNA ORF Clone, Human, N-Myc tag HG14844-NM
ATP5B qPCR Primer Pairs, Human HP103475
info info
添加购物车成功! 添加购物车失败!