FKBP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

FKBP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
327 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human FK506 binding protein 1A, 12kDa, transcript variant 12B with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 0.38kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FKBP12 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FKBP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

FKBP-12 cDNA ORF Clone, Human; FKBP-1A cDNA ORF Clone, Human; FKBP1 cDNA ORF Clone, Human; FKBP12 cDNA ORF Clone, Human; PKC12 cDNA ORF Clone, Human; PKCI2 cDNA ORF Clone, Human; PPIASE cDNA ORF Clone, Human

FKBP12 Background Information

FK56 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the immunophilin protein family who serve as receptors for the immunosuppressant drugs cyclosporin A and FK56. As a conserved molecules in many eukaryotes, FKBP12 has been characterized as a peptidyl-prolyl isomerase that catalyzes the transition between cis- and trans-proline residues, and is involved in several biochemical processes including protein folding, receptor signaling, protein trafficking and transcription. FKBP12 has attracted immense attention and its role in mediating the immunosuppressive functions. FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. In one such a role, FKBP12 interacts with and regulates the functional state of the ryanodine Ca2+ channel receptor by altering protein conformation and coordinating multi-protein complex formation. Another physiological role of FKBP12 is an interactor and a regulator of the type I serine/threonine kinase receptors of TGF-beta superfamily. Current data, derived from detailed biochemical studies as well as from functional studies in various systems, suggest that FKBP12 functions as a "guardian" for the type I receptors to prevent them from leaky signaling under sub-optimal ligand concentrations, thereby providing a molecular "gradient reader" for TGF-beta family morphogens. This aspect of FKBP12 function may be critical for cellular responsiveness to morphogenetic gradients of the TGF-beta family members during early development, serving to assure the translation of different ligand concentrations into different signaling readouts. In addition, FKBP12 may be involved in neuronal or astrocytic cytoskeletal organization and in the abnormal metabolism of tau protein in Alzheimer's disease (AD) damaged neurons.
Full Name
FK506 binding protein 1A
References
  • Wang T, et al. (2004) The immunophilin FKBP12: a molecular guardian of the TGF-beta family type I receptors. Front Biosci. 9: 619-31.
  • Sugata H, et al. (2009) A peptidyl-prolyl isomerase, FKBP12, accumulates in Alzheimer neurofibrillary tangles. Neurosci Lett. 459(2): 96-9.
  • Brath U, et al. (2009) Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition. J Mol Biol. 387(1): 233-44.
  • Scaramello CB, et al.. (2009) FKBP12 depletion leads to loss of sarcoplasmic reticulum Ca(2+) stores in rat vas deferens. J Pharmacol Sci. 109(2): 185-92.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait